Alterations in the steroid hormone receptor co-chaperone FKBPL are associated with male infertility: a case-control study

Sunnotel Olaf, Hiripi Laszlo, Lagan Kevin, Mcdaid, De, Miyagawa Yasushi, Crowe Hannah, Kaluskar Soniya, Ward Michael, Scullion Catherine, Campbell Alan, Downes Cs, Hirst David, Barton David, Mocanu Edgar, Tsujimura Akira, Cox, Robson Tracy, Walsh

Description

Male infertility is a common cause of reproductive failure in humans. In mice, targeted deletions of the genes coding for FKBP6 or FKBP52, members of the FK506 binding protein family, can result in male infertility. In the case of FKBP52, this reflects an important role in potentiating Androgen Receptor (AR) signalling in the prostate and accessory glands, but not the testis. In infertile men, no mutations of FKBP52 or FKBP6 have been found so far, but the gene for FKBP-like (FKBPL) maps to chromosome 6p21.3, an area linked to azoospermia in a group of Japanese patients. Methods To determine whether mutations in FKBPL could contribute to the azoospermic phenotype, we examined expression in mouse and human tissues by RNA array blot, RT-PCR and immunohistochemistry and sequenced the complete gene from two azoospermic patient cohorts and matching control groups. FKBPL-AR interaction was assayed using reporter constructs in vitro. Results FKBPL is strongly expressed in mouse testis, with expression upregulated at puberty. The protein is expressed in human testis in a pattern similar to FKBP52 and also enhanced AR transcriptional activity in reporter assays. We examined sixty patients from the Japanese patient group and found one inactivating mutation and one coding change, as well as a number of non-coding changes, all absent in fifty-six controls. A second, Irish patient cohort of thirty showed another two coding changes not present in thirty proven fertile controls. Conclusions Our results describe the first alterations in the gene for FKBPL in azoospermic patients and indicate a potential role in AR-mediated signalling in the testis.

Informations

• Publié par: biomed
• Publié le: 01 janvier 2010
• Nombre de lectures: 17
• Langue: English
• Poids de l'ouvrage: 1 Mo

Extrait

Sunnotel et al. Reproductive Biology and Endocrinology 2010, 8:22
http://www.rbej.com/content/8/1/22
RESEARCH Open Access
Alterations in the steroid hormone receptor
co-chaperone FKBPL are associated with male
infertility: a case-control study
1† 1† 1 1 2 3Olaf Sunnotel , Laszlo Hiripi , Kevin Lagan , Jennifer R McDaid , Johanny M De León , Yasushi Miyagawa ,
1 1 1 1 1 4 5Hannah Crowe , Soniya Kaluskar , Michael Ward , Catherine Scullion , Alan Campbell , CS Downes , David Hirst ,
6 7 3 2 5 1*David Barton , Edgar Mocanu , Akira Tsujimura , Marc B Cox , Tracy Robson , Colum P Walsh
Abstract
Background: Male infertility is a common cause of reproductive failure in humans. In mice, targeted deletions of
the genes coding for FKBP6 or FKBP52, members of the FK506 binding protein family, can result in male infertility.
In the case of FKBP52, this reflects an important role in potentiating Androgen Receptor (AR) signalling in the
prostate and accessory glands, but not the testis. In infertile men, no mutations of FKBP52 or FKBP6 have been
found so far, but the gene for FKBP-like (FKBPL) maps to chromosome 6p21.3, an area linked to azoospermia in a
group of Japanese patients.
Methods: To determine whether mutations in FKBPL could contribute to the azoospermic phenotype, we
examined expression in mouse and human tissues by RNA array blot, RT-PCR and immunohistochemistry and
sequenced the complete gene from two azoospermic patient cohorts and matching control groups. FKBPL-AR
interaction was assayed using reporter constructs in vitro.
Results: FKBPL is strongly expressed in mouse testis, with expression upregulated at puberty. The protein is
expressed in human testis in a pattern similar to FKBP52 and also enhanced AR transcriptional activity in reporter
assays. We examined sixty patients from the Japanese patient group and found one inactivating mutation and one
coding change, as well as a number of non-coding changes, all absent in fifty-six controls. A second, Irish patient
cohort of thirty showed another two coding changes not present in thirty proven fertile controls.
Conclusions: Our results describe the first alterations in the gene for FKBPL in azoospermic patients and indicate a
potential role in AR-mediated signalling in the testis.
Background Androgen insensitivity syndrome (AIS) can result in a
Genetic causes are thought to account for 10-15% of variety of defects in the affected patient, including gyne-
cases of severe male infertility [1]. Azoospermia is most comastia, cryptorchidism and hypospadias. Mild AIS
commonly associated with microdeletions of the AZF (MAIS) on the other hand can have infertility as the
gene on the Y chromosome [2,3], but mutations in the only symptom and patients often show no mutations in
androgen receptor (AR) gene [4], important for sex hor- the AR gene [5]. Defects in AR coactivators have already
mone signalling, are also associated with this phenotype. been implicated in one case of complete androgen resis-
Known mutations in these and other genes still only tance in humans [6] and in two sisters with partial resis-
account for a fraction of azoospermia cases, suggesting tance to multiple steroid hormones [7]. Homozygous
that other genetic causes remain to be discovered. deletion of the AR cochaperone FK506 binding protein
52 (FKBP52) in mice has been shown independently by
twogroupstoresultinmaleinfertility and hypospadias
* Correspondence: [e-mail]
with underdevelopment of the prostate and seminal
† Contributed equally
1 vesicles [8,9]. Both groups found evidence forTranscriptional Regulation and Epigenetics, School of Biomedical Sciences,
University of Ulster, Coleraine BT52 1SA, UK
© 2010 Sunnotel et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.Sunnotel et al. Reproductive Biology and Endocrinology 2010, 8:22 Page 2 of 8
http://www.rbej.com/content/8/1/22
compromised AR activity in the knockout mice, and excluded [17]: DNA from a control group of healthy
showed that FKBP52 potentiates AR signalling in Japanese males was obtained from the same source. The
response to androgen in prostate cell lines. Though the thirty azoospermic patient samples from Human
testes in the FKBP52 knockout mice were normal, cell Assisted Reproduction Ireland, Rotunda Hospital,
type-specific AR deletions in mice have shown a Dublin, Ireland showed no Y chromosome microdele-
requirement for the receptor in Sertoli cells during nor- tions or chromosome abnormalities: the control group
mal spermatogenesis [10,11]. This suggests that another here were thirty proven fertile males [21]. Obstructive
AR cochaperone might exist in the testis which is azoospermia was excluded for both patient groups.
required for optimal AR activity in these cells.
FK506 binding protein-like (FKBPL, aka DIR-1 and Mice
WISp39) was first described as a radioresponsive gene Tissues were collected from Swiss/To (Harlan, UK)
[12] and is a less well-characterised member of the mice, which were maintained in accordance with the
FKBP family. It demonstrates binding to heat shock pro- Home Office regulations under project licence to CPW.
tein 90 (HSP90) through its conserved tetratricopeptide
(TPR) repeats [13] and more recently it has been shown Analysis of Fkbpl mRNA expression by RT-PCR
to interact with and stimulate the activity of the gluco- Total RNA was extracted using the RNeasy Mini Kit,
corticoid receptor (GR) in human cell lines [14]. The including the optional DNAse treatment, following the
PPI domain of FKBPL lacks crucial catalytic residues manufacturer’s instructions (Qiagen, Crawley, UK) and
needed for the isomerase activity seen in other family 1 μg used to make cDNA in a 12.5 μl mixture contain-
members like FKBP6, which alters target protein confor- ing 10 mM Tris HCL (pH 8.3), 0.2 μgOligo(dT)15
mation and helps regulate assembly of multiprotein primer (Promega, Southampton, UK), 1.5 mM dNTPs,
complexes for clients such as ryanodine receptor and 1× AMV-RT buffer and 7.5 U AMV reverse transcrip-
mTOR [15]. FKBP52 has one functional PPI domain, tase (Promega, Southampton, UK). Primers specific for
but catalytic activity may not actually be required for Fkbpl (musdirf5ex CTTCCAGGCCTCAACATCAT and
FKBP52-mediated regulation of AR function [16]. musdirR TCCCAGCTCGAAACAGTTCT: chr17
FKBPL maps to human chromosome 6p21.3: linkage 34781824-34782871 NCBI build 37; cDNA 756 nt; DNA
studies in a Japanese population [17] implicate this 1028 nt) or b-actin (Bact1 GCTGTGCTATGTTGCTC-
region specifically in azoospermia (LOD score 3.5, p = TAGACTTC and Bact2 CTCAGTAACAGTCCGCCTA-
0.0005). The region contains a large number of genes, GAAGC: chr5 143665461-143666180; cDNA 500 nt;
some of which were excluded by candidate studies [18]. DNA 730 nt) were supplied by Invitrogen, Paisley, UK.
There are also three cases of chromosomal breakpoints All primers were checked for uniqueness and location
in this region leading to infertility in azoospermic males using the BLAT tool available at the UCSC website [22].
on the Mendelian CytogeneticsNetworkdatabase,with PCR was performed in 25 μl containing 1× Taq buffer,
two of these listed as azoospermic [19]. A separate 200 μMdNTPs,0.4 μM primer, 2 U Taq (Invitrogen,
report describes a family where six members carry a Paisley, UK) and 1 μl cDNA. Initial deannealing at 94°C
6p21 translocation and show male-only (n = 3) infertility for 3 min was followed by 28 cycles of 45 sec at 94°C, 1
and azoospermia [20]. minat61°C,and1minat72°Candafinalelongation
We examined FKBPL expression in mouse and human for 5 min at 72°C. PCR products were separated on
tissues and sequenced DNA from two human azoosper- agarose gels and images captured using a Kodak digital
mic patient cohorts, finding alterations in the gene. camera.
Furthermore, we provide evidence that FKBPL can
increase transcription of AR targets in response to RNA expression analysis using radioactive probes
androgen and that the altered proteins seen in patients A Mouse RNA Master Blot array normalised to provide
may be deficient in this activity. semi-quantitative data on tissue specificity and target
mRNA abundance was purchased from BD Biosciences,
Methods Cowley, UK. Human and mouse FKBPL coding-region
Subjects probes were amplified by PCR using: HumanF
Patient samples were obtained with informed consent CTAGGCTCCTGCTGCCGGCTACTG and HumanR
and approved for screening by the Ethical Approval TCAGCAGTTGCTTTTTCCAGGTCC; musdirF
committees of the respective institutes. The cohort of GAACGAGAAGAACACCGCTC and musdirR
azoospermic patients from Osaka University, Japan, have TCCCAGCTCGAAACAGTTCT. Northern blotting,
been previously described and patients showing obstruc- radiolabelling of cDNA and detection of mRNA were as
tive azoospermia or chromosomal abnormalities were previously described [23].Sunnotel et al. Reproductive Biology and Endocrinology 2010, 8:22 Page 3 of 8
http://www.rbej.com/content/8/1/22
Nucleotide sequence screening of FKBPL gene signal detected using ECL reagents (GE Healthcare,
The whole FKBPL gene was directly amplified from Amersham, UK).
patient DNA using primers 5’-GGCTCCAGGGT-
TAGTTGTCA-3’ and 5’