Cet ouvrage et des milliers d'autres font partie de la bibliothèque YouScribe
Obtenez un accès à la bibliothèque pour les lire en ligne
En savoir plus

Partagez cette publication






Synthesis of Site-Specific Artificial
Ribonucleases



Dissertation
zur Erlangung des Doktorgrades der
Naturwissenschaften


vorgelegt beim Fachbereich Biochemie, Chemie und Pharmazie
der Johann Wolfgang Goethe-Universität
in Frankfurt am Main


von
Claudio Gnaccarini
aus Verona (Italia)


Frankfurt am Main
2007
(D30)







































































Vom Fachbereich Biochemie, Chemie und Pharmazie der
Johann Wolfgang Goethe-Universität als Dissertation angenommen.











Dekan: Prof. Dr. H. Schwalbe
1. Gutachter: Prof. Dr. M. W. Göbel
2. Gutachter:
Datum der Disputation:





























































Acknowledgements

First of all, I want to thank Professor Dr. Michael Göbel for the opportunity he gave me of working
in his group and for supporting me during my studies.
I thank Dr. Ute Scheffer and Elisabeth Kalden for the tests of RNA cleavage and the help during my
biological experiments and I also thank Sascha Peter and Kathrin Beier for the collaboration in my
projects. I am obliged to: Dr. Nelly Piton and Professor Dr. Joachim Engels for the deoxyuridine
derivative, Dr. Jörg Bäumler and Dr. Manuel Grez for the Bcr-Abl peptide, Jérôme Désiré and
Professor Dr. Jean-Luc Décaut from the University of Grenoble for the neamine conjugate and to
Flavio Manea and Professor Dr. Paolo Scrimin from the University of Padova for the collaboration
on gold nanoparticles.
I am thankful for the teaching of Dr. Marcus Hey with the DNA synthesiser. A sincere thank goes to
Dr. Christo Roussev for the time we spent together in the laboratory. I thank in particular Marcel
Suhartono for the company in the laboratory and the careful lecture of my thesis.
Among my colleagues, I am indebted to Dr. Ute Scheffer, Sven Breitung, Deniz Akalay, Stefan
Ullrich, and Marko Weimar for the company, the scientific discussions and the critical lecture of
my thesis. I appreciated Gunther Seifert, Christoph Timm, Cristiano Pinto Gomes, and Mirco
Zeiger for keeping company.
Further special thanks go to Theodora Ruppenthal for the help with the administrative matters.
My work was financially supported by the ENDEVAN:“European Network on the Development of
Artificial Nucleases’’, and the SFB 579-A3 “Zufall und Design: komplementäre Wege zu neuen
RNA-Liganden’’.
I am also grateful to Ilona Prieß and Hannelore Brill for the mass spectrums, to Dr. Gottfried
Zimmerman and Reinhard Olbrich for the assistance with the NMR. I show my appreciations to
Marianne Christof for the elementary analysis, to Dr. Gerd Dürner, and to Gabriele Stracke from
the HPLC department for the purifications.
To conclude I dedicate the last and most important part of my acknowledgements to people who did
not contribute to my thesis directly, but who have helped me a lot while working on this thesis: my
family, my parents, and all those people I met in my life who trusted in me and supported me with
their affections.
Thanks to all of you.

Claudio Gnaccarini



















































Zusammenfassung A

Zusammenfassung

Seit gezeigt wurde, dass die genetischen Informationen in Form von DNA
gespeichert wird, ist das Geheimnis der DNA-Struktur gelöst, der Mechanismus der
Gen-Expression und die Rolle der RNA verstanden worden. Das Interesse für die
Chemie und die Biologie der Nukleinsäuren ist somit kontinuierlich gewachsen.
Besonders interessant ist die RNA, die eine Rolle als ein Vermittler der genetischen
Informationen (mRNA) spielt, aber auch als Bote von Aminosäuren (tRNA). Sie ist
im Ribosom (rRNA) anwesend, arbeitet als Templat in Telomerasen für DNA-
Synthese und hat außerdem wichtige Funktionen in der RNA-Spaltung, z.B. bei
Ribozymen wie RNAse P inne. Betreffend bestimmter Spaltstellen in RNA hat auch
das Phänomen der siRNA beträchtliche Aufmerksamkeit in diesem Prozess erregt.
Der sogenannte RISC-Komplex wird programmiert, einzelsträngige RNA mit hoher
Sequenz-Spezifität zu schneiden. Die für die RNA-Interferenz verantwortliche
zelluläre Maschinerie ist auch an der Bilbung von MikroRNAs beteiligt. RNA-
Interferenz ist heute eines der nützlichsten Werkzeuge in functional genomics
geworden. Die große Hoffnung ist, dass es auch vielleicht in der Therapie angewandt
werden könnte.
Das Thema meiner Doktorarbeit trägt den Titel „Synthesis of Site-Specific Artificial
Ribonucleases“. Es beschäftigt sich mit der Entwicklung künstlicher
bindungsspezifischer Ribonucleasen. Diese künstlichen Katalysatoren sind im
Wesentlichen aus drei Gründen bedeutsam:
Zum einen liegt eine mögliche Anwendung in der Affinity-Cleavage
(Affinitätsspaltung), eine Technik, die Bindungsstellen von RNA-Liganden durch
das kovalente Anbringen eines Reagenzes lokalisiert, das zwischen den
Nukleinsäuren schneidet.
Zum anderen entsteht die Möglichkeit, neue Werkzeuge für eine gezielte
Manipulation großer RNA-Moleküle zu schaffen.
Die Vorteile des Ansatzes sind, dass man damit beliebige Zielsequenzen anwählen
kann. Das Problem dieser Strategie ist die Notwendigkeit, hohe Genauigkeit im
Spaltungssschritt zu erreichen, wie zum Beispiel mit natürlichen Ribozymen.
Wichtige Ergebnisse wurden auch während meiner Arbeit erhalten, mit einem Fall B Zusammenfassung

von genauer Spaltung zwischen zwei Basen. Der dritte Grund ist die potentielle
Anwendung als katalytische antisense-Oligonucleotide in der Chemotherapie.
Gegenwärtig existieren zwei Ansätze, unspezifische künstliche RNasen relativ
kleiner Größe zu schaffen. Der erste basiert auf Metallkomplexen und führt im
Allgemeinen zu höheren Raten. Die Idee ist, ein Metall als elektrophiles Zentrum zur
Unterstützung der Transesterfikation zu nutzen. Unter diesen Katalysatoren enthalten
2+ 2+die effizientesten Lanthanid-Ionen, Cu und Zn .
Der zweite Ansatz zielt darauf ab, metallfreie künstliche Ribonucleasen zu
entwickeln. Die Vorteile dieser Strategie sind, den Katalysator von der Stabilität der
Metallkomplexe, die in vivo problematisch sein könnten, unabhängig zu machen. In
diesem Ansatz wird die natürliche Katalyse durch Enzyme simuliert. Zweckmäßige
Gruppen mit beschränkter katalytischer Aktivität z.B. als Nucleophile, Säuren oder
Basen, werden in einer Weise zusammengesetzt, um Kooperation zu ermöglichen.
Potente Katalysatoren können so ohne die Notwendigkeit von Metallen als
Cofaktoren erzeugt werden.


O CH3HN ON N
HN N
N NHH HN N N H
Tris{2-[(benzimidazol-2-yl)amino]ethyl}amine

Abb 1: RNA-Spaltungsagens in dieser Arbeit.

Unsere Gruppe hat einen der potentesten metallfreien Katalysatoren, das Tris{2-
[(benzimidazol-2-yl)amino]ethyl}amin (Abb. 1), erfolgreich entwickelt. Dieses
Molekül katalysiert die Umesterung der Phosphodiesterbindung von RNA.
Allerdings wurde die mechanistische Charakterisierung z.B. durch die pH-Wert-
abhängige Tendenz zur Aggregation mit der Zunahme des pH-Wertes kompliziert.
Um dieses Problem zu lösen und um regiospezifische Spaltung zu erreichen, wurden
während meiner Arbeit vier verschiedene 5'- DNA-Konjugate hergestellt, die über
Disulfid-Bindungen verknüpft waren (Abb. 2: 1000, 1001, 1002 1006). Zusammenfassung C

Die RNA-Spaltungstests dieser Konjugate bewiesen ohne jeden Zweifel die Aktivität
von Aminobenzimidazol-Katalysatoren. Weiterhin wurde eine pH-Abhängigkeit der
Aktivität festgestellt, welche
-NH O OH ein Optimum bei einem pH-SN NH N S P ON OHN OHH NH DNANN N Wert von 8 zeigte. Ein hohes
N
5' 3' Niveau regiospezifischer 1000catalyst-linker- TCGGCAGTCGGCTAG
5' 3'catalyst-linker- GATCGGCAGTCGGCTAG 1001 Spaltung wurde durch die
5' 3'catalyst-linker- CGAGATCGGCAGTCGGCTAG 1002
Verwendung von Helfer- 5' 3' 1006catalyst-linker- CTCCTGACAAGGTAT
Oligonucleotiden erreicht. 5' 3' PNA-Oligo1011catalyst-linker- tcggcagtcg

Ein analoges PNA-Konjugat Abb 2: 5’-Oligonucleotid-Konjugate.
wurde ebenfalls synthetisiert
(Abb. 2: 1011), welches sich aber interessanterweise als inaktiv erwies. Die Gründe
dieses Misserfolges müssen noch geklärt werden. Auch wenn Anwendungen in vivo
immer noch schwerer erreichbar scheinen, könnten diese Konjugate in vitro als
sequenzspezifische künstlichen RNasen eingesetzt werden. Einige Fragen über den
Mechanismus des Katalysators sind noch offen, doch könnten weitere wichtige
Hinweise von einem Kristall des Katalysator-Substrat-Komplexes kommen. Weitere
Studien, die die Wirkungsweise
N
HN dieser Aminobenzimidazol-N
HN
NN
H NH HN
N NNSS Katalysatoren aufklären, sind HHO
1007
O
NH wichtig, um neue Spaltagentien zu
O O
O P OO P O TCGGCTAG-3'5'-GAGATCGG
-O -O entwerfen, die es erlauben,
N
HN
N
HN
N N vielversprechende Ergebnisse für in H NH HN
N N NS S H HO
vivo-Anwendungen zu erhalten.
Diese 5'-Konjugate zeigten wie
O1008
NH
O O erwartet keinen turnover.
O P O O P O5'-GAGATCGG TCGGCTAG-3'
-O -O
N
HN Infolgedessen wurde eine neue N
N H
NH N
N NHS S HNN NO H Klasse von Konjugaten entworfen, H
O
NH
die den Katalysator in der Mitte der
O
1004 NHN DNA-Stränge tragen, um
O OO O
O P OO P O CGGCTAG-3'5'-AGATCGGC
-O-O mehrfachen turnover zu erlauben
Abb. 3: Oligonucleotid- Konjugate, die turnover
(Abb. 3). Von diesem neuen zeigen.
Konjugat basierten zwei auf Serinol, D Zusammenfassung

1007, 1008 und eins auf einem modifizierten Nukleotid (1004). Das Konjugat 1007,
basierend auf Serinol mit einem kurzen Linker erwies sich als das Aktivste. Diese
Moleküle erreichten eine erfolgreiche regiospezifische Spaltung und außerdem
-1mehrfachen turnover. Für 1007 wurde ein ungefährer k von 0.03 h erhalten. cat
Betreffend dieses Projektes bleibt es immer noch, die Spezifität und die Effizienz zu
erforschen, die von der bulge-Größe abhängen. Dieses Problem konnte ohne
besonderen Aufwand einer speziellen Synthese von einem neuem Substrat gelöst
werden, welches bulges der gewünschten Größe ausbilden kann.
Auf einer Arbeit von Häner
10123'-TATGGAACAGTC- - CTTC-
basierend wurde eine alternative
2105'-AUACCUUGUCAG GAAGAGAGGCCGUUA-3'
GA Strategie, die turnover erlaubt,
angewendet, und zwar durch die
10123'-TATGGAACAG TCCTTC-
Synthese von 1012 (Abb. 4). Dieses 5'-AUACCUUGUCAGGAGAAGAGAGGCCGUUA-3' 210
Abb. 4: 5’-Oligonucleotid Konjugat, um turnover neue DNA-Konjugat wurde
zu erreichen.
hergestellt, um am 5' -Ende durch
eine Amid-Bindung den Katalysator zu tragen. In Analogie zur Arbeit von Häner
wurde erwartet, dass Konjugat 1012 einen bulge mit Substrat 210 bildet. Dieser
bulge ist die primäre Spaltungsstelle in der Arbeit von Häner gewesen (Abb. 4).
Leider scheint in unserem Fall die Formation des bulges nicht energetisch begünstigt
zu sein, während eine alternative bulgeless doppelsträngige Struktur mehr bevorzugt
zu sein scheint. Deshalb kam die Spaltung ausschließlich im einzelsträngigem
Bereich vor (ohne turnover). Hier wird deutlich, dass der Schlüssel zum Verständnis
dieses Projektes das Wissen über die Stabilisierung der bulge-Formation ist.
Nach diesen Konjugationsstudien
30
O37
N
H mit der DNA erschien der Tris(2-ON OHNO N OH
O NHN NH HNN N
N aminobenzimidazol)- Katalysator N NHHN H HNN NN NNH H
H HN NN
H für Anwendungen wie
O 80
N
OH
OHN Affinitätsspaltung geeignet. Um O O OHN O HNNH NN N
N HN HN HNN NNN NH NHH diese Anwendung zu prüfen H HN HN NN NN H H
Abb. 5: Tris(benzimidazole) geeignet für wurden andere Derivate
Konjugation.
hergestellt, die geeignet waren für
Konjugation über Amid-Bindungen und über Maleimid-Chemie (Abb. 5). 37
benutzend wurden vier verschiedene Peptidkonjugate synthetisiert (Abb. 6). 2001

Un pour Un
Permettre à tous d'accéder à la lecture
Pour chaque accès à la bibliothèque, YouScribe donne un accès à une personne dans le besoin