Comparaison de sols résistants ou non à la maladie du piétin-échaudage du blé par une approche puces

De
Publié par

Les Actes du BRG, 6 (2006) 197-209© BRG, 2006Article originalComparaison de sols résistant ou non à lamaladie du piétin-échaudage du blé par uneapproche puce à ADN taxonomique 16S ciblantles bactéries rhizosphériques phytoprotectricesdu genre(1) (2) (1)Hervé SANGUIN , Kévin GAZENGEL , Lionel KRONEISEN ,(1) (1)Claire PRIGENT-COMBARET , Geneviève GRUNDMANN ,(2) (1)*Alain SARNIGUET , Yvan MOËNNE-LOCCOZ(1)UMR CNRS 5557 Écologie Microbienne, IFR 41 Bio-Environnement et Santé,Université Lyon 1, 43 bd du 11 Novembre 1918, 69622 Villeurbanne Cedex, France(2)UMR INRA Biologie des Organismes et des Populations Appliquée à la Protec-tion des Plantes, Domaine de la Motte, BP 35327,35653 Le Rheu Cedex, FranceAbstract: Comparison of soils suppressive or not to take-all disease of wheatby 16S taxonomic microarray targeting plant-protecting rhizospherebacteria. Take-all is an important wheat disease caused by the soil-bornefungus Gaeumannomyces graminis var. tritici. Disease severity can be high, but a declineof take-all disease may take place in the following years in case of wheat monocrop-ping. Microbial populations known to be associated to take-all decline (diseasesuppressiveness) include culturable antagonistic fluorescent Pseudomonas spp. pro-ducing the antifungal compound 2,4-diacetylphloroglucinol. The objective of thisstudy was to assess changes in the diversity of rhizosphere pseudomonads linkedwith take-all decline of wheat, following a ...
Publié le : samedi 24 septembre 2011
Lecture(s) : 130
Nombre de pages : 13
Voir plus Voir moins
LesActesduBRG,6(2006)197-209©BRG,2006ArticleoriginalComparaisondesolsrésistantounonàlamaladiedupiétin-échaudagedubléparuneapprochepuceàADNtaxonomique16SciblantlesbactériesrhizosphériquesphytoprotectricesdugenreHervéSANGUIN(1),KévinGAZENGEL(2),LionelKRONEISEN(1),(1)(1)ClairePRIGENT-COMBARET,GenevièveGRUNDMANN,AlainSARNIGUET(2),YvanMOËNNE-LOCCOZ(1)*(1)UMRCNRS5557ÉcologieMicrobienne,IFR41Bio-EnvironnementetSanté,UniversitéLyon1,43bddu11Novembre1918,69622VilleurbanneCedex,France(2)UMRINRABiologiedesOrganismesetdesPopulationsAppliquéeàlaProtec-tiondesPlantes,DomainedelaMotte,BP35327,35653LeRheuCedex,FranceAbstract:Comparisonofsoilssuppressiveornottotake-alldiseaseofwheatby16Staxonomicmicroarraytargetingplant-protectingrhizospherebacteria.Take-allisanimportantwheatdiseasecausedbythesoil-bornefungusGaeumannomycesgraminisvar.tritici.Diseaseseveritycanbehigh,butadeclineoftake-alldiseasemaytakeplaceinthefollowingyearsincaseofwheatmonocrop-ping.Microbialpopulationsknowntobeassociatedtotake-alldecline(diseasesuppressiveness)includeculturableantagonisticfluorescentPseudomonasspp.pro-ducingtheantifungalcompound2,4-diacetylphloroglucinol.Theobjectiveofthisstudywastoassesschangesinthediversityofrhizospherepseudomonadslinkedwithtake-alldeclineofwheat,followingaculture-independentapproachbasedontheuseofa16SrRNA-basedtaxonomicmicroarray.Themicroarraycontainsabout700probes,whichtargetbacteriaatvarioustaxonomiclevels.Certainprobes(about70)targetpseudomonads,includinggroupsofbiocontrolPseudomonasstrains(about20probes).Thelatterweredefinedinthisworkafterphylogeneticanalysisof16SrRNAsequencesavailableindatabasesforbiocontrolstrainsandotherpseudomo-nads,basedonNeighborJoining(withKimura2parameter)andMaximumParci-monymethods.ThemicroarrayprobesweredefinedusingARBsoftware(http://www.arb-home.de)andtheywerecheckedinsilico.Mosthaveameltingtemperatureof65±5°C,GC>50%,nosecondarystructureorasecondarystruc-turewitha-2kcalmol-1andmeltingtemperature<50°C,andtheydonotformstablehomoduplex.Theprobeswerespottedby5’C6-NH2covalentlinkonslides.Eachbasicpatternfortheprobesetisreplicatedthreetimesperslide.RhizospheresampleswerecollectedattheINRAstationofLaGruche(Brittany,*Correspondanceettirésàpart:moenne@biomserv.univ-lyon1.fr791
H.Sanguinetal.France)fromplotsgrownwithwheatforoneyear(treatmentPI;lowleveloftake-alldisease),fiveyears(treatmentPV;highlevelofdisease)ortenyears(treatmentPX;lowlevelofdisease,suppressivenessreached).Thisexperimentalset-upen-abledcomparisonoftreatmentsundersameconditionsofsoilcomposition,micro-climate,wheatcultivarandfarmingtechniques.RhizosphereDNAwasextractedandsubjectedtoPCRusingprimingconditionsdesignedinthisworktotargetbiocontrolpseudomonads.ClusteranalysisofmicroarraydataobtainedafterPCRofPseudomonaspopulationsinthewheatrhizospherediscriminatedmainlybetweentreatmentsPIandPX,treatmentPVbeinginanintermediateposition.TheresultsareinaccordancewithquantitativePCRdataobtainedforthetotalpseudomonads.Overall,treatmentPXappearstobeassociatedwithaparticularcompositioninbiocontrolpseudomonads(whichcomprisebiocontrolstrainsproducing2,4-diacetylphloroglucinol).Thesefindingsindicatethatthe16Staxonomicmicroarrayisapromisingtoolforanalysisofbacterialdiversityassociatedwithdisease-suppressivesoils.bacterialcommunity/rhizosphere/soildiseasesuppressiveness/16Staxo-nomicmicroarray/quantitativePCRRésumé:Lepiétin-échaudagedubléestunemaladiecauséeparlechampignonGaeumannomycesgraminisvar.tritici.Lamonoculturepeutentraînerunerésistancedusolàlamaladie,etcertainsPseudomonasspp.fluorescentssontimpliqués.CesPseudomonasrhizosphériquesontétéétudiésparuneapprochedetypepuceàADNtaxonomiqueciblantl’ADNr16S.Lapucecontientenviron700sondes;70correspondentauxPseudomonas,etparmiellesunevingtainecibledesgroupesdesouchesphytoprotectri-ces.LeséchantillonsproviennentdeLaGruche,oùlebléestcultivédepuis1an(peudesymptômesdepiétin-échaudage),5ans(symptômesélevés)ou10ans(symptômeslimités;résistanceàlamaladie).UneamplificationPCRdesPseudomonasspp.fluores-centsrhizosphériquesaétéréalisée.L’analysemultivariéedesrésultatsdistinguelestraitements1anet10ans,letraitement5ansprésentantunesituationintermédiaire.LesrésultatssontenaccordaveclesdonnéesdePCRquantitativesurlesPseudomonastotaux.Letraitement10ansestassociéàdesgroupesparticuliersdesouchesphyto-protectricesquiproduisentdu2,4-diacétylphloroglucinol.Cetteétudeamontrél’intérêtdel’approchepuceàADNpourétudierladiversitédesPseudomonasassociésàlarésistancedusolaupiétin-échaudagedublé.communautébactérienne/rhizosphère/résistancedusolauxmaladies/puceàADNtaxonomique16S/PCRquantitative1.INTRODUCTIONLepiétin-échaudagedubléestunemaladiecauséeparlechampignontel-luriquephytopathogèneGaeumannomycesgraminisvar.tritici[22].Lorsd’unemonoculturedeblé,cettemaladiedevientprogressivementplusimportanteetpeutalorscauserdesdégâtsimportants.Néanmoins,dansdenombreux189
DiversitédesPseudomonasassociésàlarésistancedusolauxmaladies,étudiéeparpuceàADNcas,unphénomènederésistancedusolàlamaladie(appelédéclin)semetprogressivementenplacelesannéessuivantes,permettantd’atteindreunétatderésistancedusolàlamaladie[21],[28].PlusieursétudesontmisenévidencelerôleimportantdesPseudomonasspp.fluorescentsproducteursducomposéantifongique2,4-diacétylphloroglucinoldanscedéclindupiétin-échaudage[4],[15],[27].Ils’agitdebactériesdontlescapacitésphytoprotectricesontétémisesenévidencedansplusieurstypesdepathosystèmesdifférents[7],[14].LespopulationscultivablesdePseudomonasspp.fluorescentsproducteursde2,4-diacétylphloroglucinolontétécaractéri-séesauniveaudeplusieurssolsrésistants[14],ycomprisdanslecasdelarésistanceaupiétin-échaudagedublé[4],[27].Néanmoins,laplupartdesré-sultatsdisponiblesjusqu’icidécouledel’analysedepopulationsbactériennescultivables.Denombreusesméthodesmoléculairesexistentpouranalyserladiversitédespopulationsbactériennes.Lamajoritéd’entreelles(DGGE,etc.)corres-pondàdesméthodesd’empreintegénétique,quinepermettentpasuneiden-tificationaiséedestaxonsimpliqués.Plusrécemment,desapprochesdetypepuceàADNtaxonomiqueontétéproposéespourpalliercettelimitation.Ellessontgénéralementfondéessurlegènerrs[13],[18],quicodel’ARNribosomique16S.CetteapprochepuceàADNtaxonomiqueadéjàétésuiviepourl’analysedelacompositiondelacommunautébactériennerhizosphéri-que[18],[20].L’objectifdeceprojetétaitd’analyser,àl’aided’unepuceàADNtaxonomi-queciblantl’ADNr16S,labiodiversitédesPseudomonasfluorescentsrhizosphé-riquesenrelationavecledéclindupiétin-échaudagedublé.LeprototypedepuceàADNtaxonomiquedeSanguinetal.[20]aétécomplétéavecdessondesciblantdesPseudomonas,ycomprisdesPseudomonasphytoprotecteurs.Ensuite,l’outilpuceàADNetlaPCRquantitativeontétéutiliséspourcomparerdessolsrésistantsounonaupiétin-échaudagedublé.2.MATÉRIELETMÉTHODES2.1.AnalysedesphytoprotecteursLesséquencesd’ARNr16SdePseudomonasphytoprotecteursdisponiblesdanslesbasesdedonnéesontalignéesavecCLUSTALX[25],etdesanaly-sesphylogénétiquesontétéréaliséesavecMEGAversion3.0[10].Lesmé-thodesutiliséesétaientleNeighborJoining(NJ)[19],avecleparamètreKimura2(K2P),etlemaximumdeparcimonie(MP)[2].991
H.Sanguinetal.2.2.DessindessondesLessondesontétéconçuesenutilisantlelogicielARB[11](http://www.arb-home.de),commedécrit[20].Laqualitédessondesaétéévaluéeinsilico(températuredefusionTm,énergielibresecondaires)avecOligo5(MolecularBiologyinsights,WestCascade,CO).LaplupartdessondesretenuesontunTmde65±5°C,unGC>50%,pasdestructuresecondaire(oustructuresecondaireavec-2kcalmol-1etTm<50°C)etneformentpasd’homoduplexstable.2.3.PréparationdeslamesLessondesontétésynthétiséesparEurogentec(Seraing,Belgique)avecungroupeC6-NH2en5’pourliaisoncovalente[6]surlamealdéhydeAL(SchottNexterionAG,Mainz,Allemagne).Letraitementdessondes,leurfixationsurlame,lesconditionsdeconservationdeslames,etlestraitementsdeslamesavanthybridationsontdécritsparSanguinetal.[20].L’agencementdebasecomprenddeuxcopiesdestémoinsEUB338etEUB342(témoinspositifsetbornespourl’analysed’image)etunecopiedechacunedesautressondes.Cetagencementdebaseestrépététroisfoispar.emal2.4.Échantillonsdesolrhizosphériqueetextractiond’ADNLedispositifexpérimentalINRAdeLaGruche(àPacé,IlleetVilaine)estunchamp(luvisol)subdiviséenplusieursparcellesayantsubidescyclesdiffé-rentsdeculturedeblé.LesinfestationsparG.graminisvar.triticisontnaturelles(pasd’apportd’inoculum).Pour2004,lestraitementsétaientlessuivants:PI=1annéedeculturedeblé(peudesymptômesdemaladie),PV=5an-néesdeculturedeblé(symptômesimportants),etPX=10annéesdeculturedeblé(peudesymptômesdemaladie;étatderésistancedusol).Unéchantillonnageaétéeffectuédans3parcellespourchaquetraite-ment,avec2plantespourchaqueparcelle.Pourlesplantesprélevées,leniveaud’attaquedusystèmeracinaireparG.graminisvar.triticiétaitde14(16)%pourPI,69(21)%pourPV,et24(24)%pourPX,cesvaleursétantreprésentativesdecellespourl’ensembledesparcelles[Lebretonetal.,nonpublié].Lesolrhizosphérique(adhérentauxracines)aétérecueillipourchaqueplante[3],donnantdeséchantillonsde0,5gdesol.L’extractiond’ADNdeséchantillonsderhizosphèreaétéeffectuéecommedécritparGriffithetal.[5].002
DiversitédesPseudomonasassociésàlarésistancedusolauxmaladies,étudiéeparpuceàADN2.5.AmplificationPCRdeetmarquagepourl’hybridationPourrrs,lesdeuxamorcessensétaientPseuBC2-10rc(5’-GAGCGGTAGAGAGGTGCTTG-3’)etPseu5rc(5’-AGCACGGGTACTTGTACCTG-3’),combinéesà16SPSER[23].Cesdeuxcombinaisonsd’amorcesdonnentdesampliconsde1,4kb.Ellespermettentd’amplifierrrsàpartirdetouslesPseudomonasphytoprotecteurstestésetce,avecunebonnespécificité.Eneffet,desamplificationshorsdesPseudomonasphytoprotec-teursontseulementétéobservéesdanslecasdeP.syringae(nonpublié),uneespècephytopathogènequin’estpasdocumentéecommepouvantcoloniserlarhizosphèredemanièresignificative.LesamorcessenscomprenaientunsitepromoteurT7(5’-TAATACGACTCACTATAG-3’)en5’,cequiper-metensuiteunetranscriptioninvitrogrâceàlapolyméraseARNT7.LemélangePCR(50µl)contenaitdutamponderéaction1,0,25µMdechaqueamorcesens(PseuBC2-10rcetPseu5rc)et0,5µMdel’amorce16SPSER,1,5mMMgCl2,50µMdechaquedNTP,15ngd’ADN,0,025mgml-1deT4Gene32(RocheAppliedScience,Meylan)et1,25UdeTaqEx-pandHighFidelity(RocheAppliedScience).LaPCRcomprenaitunedénatu-rationà94°Cpour3min,35cyclesavec45sdedénaturationà94°C,45sd’appariementà61°C,90sd’élongationà72°C,etuneélongationfinalede7minà72°C.LesproduitsPCRontétépurifiéssurcolonnePCRQIAquick(QIAGEN).LaconcentrationenADNaétédeterminéeparDOà260nm.Lemarquagedesamplicons16SparCy3-UTP(AmershamBiosciencesEuropeGmbH,Saclay)aétéréalisépartranscriptioninvitro,commedécrit.]42[2.6.Hybridation,lecture,ettraitementdesdonnéespuceàADNLesconditionsd’hybridationsontcellesdeSanguinetal.[20],àpartirde400ngd’ARNmarqué.Deuxlamesontétéutiliséesparéchantillon.Leslamesontétébalayéesà532nm(pourCy3)àl’aided’unscannerGeneTacLSIV(GenomicSolutions,Huntingdon,GB).Lesimagesontétéanalysées[20]aveclelogicielGENEPIX4.01(Axon,UnionCity,CA).LetraitementdesdonnéesaétéeffectuéenutilisantR(http://www.r-project.org),commedécrit[20].Laracinecarréedesvaleursd’intensité(mé-dianedusignalmoinsbruitdefond)aétéexpriméeentermedepourcen-tagedel’intensitétotaledetouteslessondesdel’agencementdebase.Unesondeaétéconsidéréepositivequandi)savaleurexcédaitcelledestémoinsnégatifsplus2écart-typesetii)aumoins2des3copiesdonnaientunrésul-tatpositif.Laclassificationhiérarchique(clustering)desdonnéesd’hybridationaétéréaliséesousR(Ward/distanceEuclidienne).102
H.Sanguinetal.2.7.PCRquantitativeLeséchantillonsderhizosphèreétudiésparpuceàADNontégalementétéanalysésparPCRquantitativepourestimerlespopulationsdePseudomo-nasspp.totaux.Laquantitéd’amplicongénéréeaveclesamorcespA/Pseu1r(233pb)aétémesuréesurABIPrism770HT(AppliedBiosystem)aveclemélangeréactionnelsuivant:10,5µleau,12,5µlMastermixTaq-SybrGreen2(KitQuickGoldStar,Eurogentec),0,5µldechaqueamorce(à12,5µM)et1µldel’ADNextraitde0,5gdesolrhizosphérique.LaPCRquantitativeestconduiteavecuncyclede3minà95°Cet40cyclesà2étapesde15sà95°Cet1minà60°C.Lapuretéduproduitamplifiéestvérifiéeparleprogrammededissociationsuivant:15sà95°C,20sà60°C,unemontéeprogressivependant19min59sjusqu’à95°C,puis15sà95°C.LaquantificationestréaliséeenréférenceàunePCRquantitativeaveclesamorcespA/Pseu1rsur1µld’unegammeétalonde1,4ngà0,007ngdel’amplifiatobtenuparPCRaveclesamorcespA/pH’surADNex-traitdesolrhizosphérique.3.RÉSULTATS3.1.PhylogéniedesphytoprotecteursNosrésultatsindiquentquelesPseudomonasphytoprotecteursdontlasé-quencerrsestconnueappartiennentàtroisgroupesphylogénétiquesmajeurs(tabl.I),àsavoirlescomplexesd’espècesdénotés«P.fluorescens»et«P.chloro-raphis»parAnzaietal.,[1],ainsiquelegroupeARDRA1définiparKeeletal.[9]surlabasedesrésultatsd’amplified16SribosomalDNArestrictionanalysis(ARDRA),confirmantlesrésultatspubliéssurd’autrescollectionsdesouches[16],[17].Septgroupesdesouchesphytoprotectrices(BC-AtoBC-G)ontétédistinguésdanscetravail(tabl.I),quellequesoitlaméthodephylogénétiqueutilisée.Lamajoritédessouchesantagonistesisoléesdubléàpartirdesolrésistantaupiétin-échaudageappartientaugroupeBC-G.202
DiversitédesPseudomonasassociésàlarésistancedusolauxmaladies,étudiéeparpuceàADNTableauI:GroupesdePseudomonasdéfinisdanscetteétudesurlabasedecritèresphylogénétiquesetdistributiondanscesgroupesdesouchesphytoprotectricesdelalittérature.Planted’originepourdessouchesphytoprotectricesemblématiquesGroupesdesouchesInformationAutresphytoprotectricestaxonomiqueBlémonocotsDicotsBC-AGroupePFCHA0,Pf1,Pf-5,ARDRA1PGNR1Complexe«P.IAM12353,BC-Bchlororaphis»DSM6698TBC-CComplexe«P.K94.23K94.08,SBW25,fluorescens»Ki353Complexe«P.BC-Dfluorescens»PCL1171DR54Complexe«P.BC-Efluorescens»F113,ATCC29736TComplexe«P.BC-Ffluorescens»PITR2PILH1,SBK26KD,Pf29A,K92.46,CM1’A2,BC-GComplexe«P.Q65c80,Q2-3-1TM1A3,NFM421,fluorescens»87,Q37-87,K94.31P97.303.2.SondespourphytoprotecteursParmilessondesconçuespourdesPseudomonas,12apparaissentcommeprésentantunintérêtparticulierpourl’étudedePseudomonasphytoprotec-teurs(tabl.II).Surlabasedesanalysesinsilico,4d’entreelles(Pseu4àPseu7)permettentl’étudedessouchesdugroupeBC-A.Les8autressondessontPseuChlo(pourdessouchesBC-B),PseuBC4-3(pourdessouchesBC-C,BC-FetBC-G),Pseu20,Pseu22,PseuBC2-10,PseuBC2BC3etPseuBC2BC3-2(pourdessouchesBC-DàBC-G),etPseu28(pourdessouchesBC-E).Aucunesondesatisfaisanten’apuêtreconçuepourBC-CoupourunedistinctionefficaceentreBC-D,BC-FetBC-G.L’analyseparclusteringdesrésultatsd’hybridationexpérimentaleobtenusavecunedou-zainedesouchesdePseudomonasmontrequelessouchespeuventainsiêtredistinguéeslesunesdesautres(nonmontré).302
H.Sanguinetal.TableauII:SondesclésciblantdesPseudomonas.SondeSpécificitéaSéquence5’3’GAM-mrc2bGammaproteobacteriaTGTTATCGAGACTCCTGCCGCCAGC-Pseu1Pseudomonasspp.TAATCCGACCTAGGCTCATCPseuDbPseudomonasspp.ACCTAGGCTCATCTGATAGC-GCAAGGPseu4GroupeBC-AetP.syringaeCACCAGGTACAAGTACCCGTPseu5GroupeBC-AetP.syringaeCAGGTACAAGTACCCGTGCTPseu6GroupeBC-AetP.syringaeACCAGGTACAAGTACCCGTGPseu7GroupeBC-AetP.syringaeCCACCAGGTACAAGTACCCGPseuChloP.chlororaphis(BC-B)GGTAAGTACCCTTCCTCCCAPseuBC4-3QuelquessouchesdeBC-C,BC-FetBC-GCCCACTCATGAATCACACCGPseu20PlupartdessouchesdeBC-D,BC-E,BC-FetCGCTCTCAAGAGGTGCAAGCBC-G,unesouchedeBC-BetP.liniPseu22PBlCup-aGr,tudneesssoouucchheesddeeBBCC--BDet,PB.Cli-nEi,BC-FetCTCTCAAGAGGTGCAAGCACPseu28GroupeBC-EGTAACGTCAAGACACCAACGPseuBC2-10GroupeBC-D[saufP.corrugata],BC-E,BC-F,CAAGCACCTCTCTACCGCTCBC-G,unesouchedeBC-BetP.liniPseuBC2BC3GroupeBC-D[saufP.corrugata],BC-E,BC-F,GTGCAAGCACCTCTCTACCGBC-G,unesouchedeBC-BetP.liniPseuBC2BC3-2BGCro-uGp,eunBeCs-oDuc[shaeufdeP.BcoCr-ruBgaettaP],.lBinCi-E,BC-F,TGCAAGCACCTCTCTACCGCaCiblethéoriquesurlabased’unappariementparfait.bGAM-mrc2estdérivéedeHiraishietal.8etPseuDaétéconçueparRudietal.18.3.3.AnalysedessolsparpuceàADNLapuceàADNtaxonomiqueaétéutiliséepouranalyserlarésistancedessolsdelaGruche.LessondesneciblantpaslesPseudomonasn’ontpasdonnédesignald’hybridation,cequiétaitattendu.Lafigure1montrelesrésultatsdeclusteringdesdonnéesd’hybridationdelapucepourlestraitementsPI(1annéedeculturedeblé;peudesymptômesdemaladie),PV(5annéesdeculturedeblé;symptômesimportants),etPX(10annéesdeculturedeblé;peudesymptômesdemaladie/étatderésistancedusol).UneamplificationPCRdesPseudomonasspp.fluorescentsaétéréalisée.L’analysedistinguelestraitements1anet10ans.Pourletraitement5ans,l’échantillonV41estgroupéavecceuxdutraitementPX,alorsqueleséchantillonsV21etV51sontgroupésavecceuxdutraitementPI.LetraitementPX(10ans)estdoncassociéàunecompositionparticulièredesPseudomonasdanslarhizosphèredublé.402
DiversitédesPseudomonasassociésàlarésistancedusolauxmaladies,étudiéeparpuceàADNPXPX+PVPIPI+PVFigure1:Résultatsdeclusteringdesdonnéesd’hybridationdelapuceàADNtaxonomiquedanslecasdesampliconsPCRPseudomonasobtenusdelarhizosphèredubléausitedeLaGruche.LestraitementsétudiéssontPI(1annéedeculturedeblé;peudesymptômesdemaladie),PV(5annéesdeculturedeblé;symptômesimportants),etPX(10annéesdeculturedeblé;peudesymptômesdemaladie/étatderésistancedusol).LeséchantillonsPIsontnotés:I21,I41etI51;leséchan-tillonsPV:V21,V41etV51;etleséchantillonsPX:X21,X41etX51.Lessiglesquisuiventlenomdeséchantillonsbiologiquescorrespondentauxrépétitionsmé-thodologiquesdel’hybridation.3.4.Analysedesspp.parPCRquantitativeLorsqueleséchantillonsderhizosphèreontétéétudiésparPCRquanti-tative,enutilisantdesamorcespourlesPseudomonasspp.totaux,lesrésultatsontdonnéenviron2,0(1,0)1010copiesg-1solpourPIetpourPX,alorsquelerésultatpourletraitementPV(phasedesensibilitéélevéeàlamala-die;6,0(3,2)1010copiesg-1sol)étaitstatistiquementsupérieur(testdeNewmann-KeulsàP<0,05).4.DISCUSSIONCommecetravailaconcernélespopulationsrhizosphériquesdePseudomo-nas,ungenredontl’organisationtaxonomiqueestactuellementmaldéfinie,septgroupesphylogénétiquesontétédéfinisiciàpartirdesouchesdePseudo-monasphytoprotectricesparmilesmieuxconnuesdanslalittérature[7],[9],[26].Cesgroupessesituentdanslescomplexes«P.fluorescens»(pourBC-Cà025
H.Sanguinetal.BC-G)et«P.chlororaphis»(pourBC-B),oucorrespondentaugroupeARDRA1encequiconcerneBC-A.Cedernierrassembledessouchesphytoprotectri-cesproduisantàlafoisdu2,4-diacétylphloroglucinoletdelapyolutéorine[9].Lesseptgroupesconstituésicisontglobalementcompatiblesaveclessubdivi-sionsfaitessurlabasedei)l’ARDRA[9],ii)lesanalysesRAPD[9],iii)laRFLPsurphlD[26],etiv)lesétudesphylogénétiquessurhcnBC(synthèsedel’HCN)[16]ethrcN(systèmedesécrétiondetypeIII)[17].Lessouchesiso-léesdublédansuncontextededéclindupiétin-échaudagesontdanslegroupeBC-G.L’identificationdeseptgroupesphylogénétiquespourlessouchesdePseudomonasphytoprotectricesafacilitélesprocéduresdedessindesondes16Spourlapucetaxonomique.Cependant,leniveaudepolymorphismederrspourcesbactériesn’apaspermisd’obtenirdessondesspécifiquespourchacundesseptgroupes.Lesrésultatsd’hybridationsursouchespuresindi-quentquelapuceàADNpeutdiscriminerprincipalemententrei)BC-A,ii)BC-E,etiii)BC-B,BC-D,BC-FetBC-G.LesampliconsPseudomonasétudiésauniveaudeséchantillonsdeLaGru-cheontétéobtenusavecdeuxjeuxd’amorces,cartouteslessouchesphyto-protectricesnepouvaientêtreamplifiéesavecunseuljeud’amorce.LesPseu-domonasrhizosphériquesproducteursde2,4-diacétylphloroglucinolsontplusnombreuxdanslessolsrésistantsaupiétin-échaudagedublécomparésauxsolsnonrésistants[15].Ici,lesrésultatsd’hybridationpourleséchantillonsrhizosphériquesindiquentquelaplupartdessondespourlesPseudomonasphy-toprotecteursahybridé,quelquesoitl’échantillonconsidéré.CecisuggèrequelarhizosphèredubléestcoloniséesimultanémentpardifférentstypesdePseu-domonas,dontdessouchesphytoprotectrices.DesPseudomonasphytoprotec-teurssonteneffetaisésàobteniràpartirdublédansdessolsrésistants[27].Néanmoins,letraitementPX(étatrésistant)estassociéàunecompositionparticulièreensouchesdePseudomonasdanslarhizosphèredeblé.PourcequiestdesPseudomonastotaux,ilapparaîtquelesniveauxdepo-pulationétaientplusélevéspourletraitementPV(étatsensible),quel’onconsidèrelesdonnéesd’hybridationoucellesdePCRquantitative.Cesré-sultats,quis’expliquentparlefaitquelesnécrosesracinaireslibèrentdessubstratsorganiquesstimulantlacroissancedesPseudomonas,sontuneconfirmationderésultatspubliés[12],[21],[22].Autotal,lesrésultatsdecetteétudepréliminairemontrentl’intérêtdel’approchepuceàADNtaxo-nomique16Spourcomparerdessolsrésistantsetnonrésistantsaupiétin-échaudagedublé,cetteapprochepermettantaussidecaractériserlesres-sourcesgénétiquesbactériennesassociéesàlarésistancedusolàlamaladie.602
DiversitédesPseudomonasassociésàlarésistancedusolauxmaladies,étudiéeparpuceàADNREMERCIEMENTSLesanalysespuceàADNontétéeffectuéesenrelationaveclaplateformetechniqueDTAMB/GénopôleRhône-Alpes,auniveaudel’IFR41«Bio-EnvironnementetSanté»situéeàl’UniversitéLyon1.NousremercionsJ.BERNILLONetC.OGER(DTAMB)pourleuraideauniveaudel’approchepuceàADN,etL.LEBRETON,P.LUCASetS.CARILLO(UMRBiologiedesOrganismesetdesPopulationsAppliquéeàlaProtectiondesPlantes,INRALeRheu)pourlesuiviépidémiologiqueausitedeLaGruche.RÉFÉRENCES[1]AnzaiY.,KimH.,ParkJ.,WakabayashiH.,OyaizuH.,Phylogeneticaffiliationofthepseudomonadsbasedon16SrRNAsequence,Int.J.Syst.Evol.Micro-biol.50(2000)1563-1589.[2]BerryV.,GascuelO.,Ontheinterpretationofbootstraptrees:Appropriatethresholdofcladeselectionandinducedgain,Mol.Biol.Evol.13(1996)999-.1101[3]ChaponA.,BoutinM.,RiméD.,DelalandeL.,GuillermA.Y.,SarniguetA.,DirectandspecificassessmentofcolonisationofwheatrhizoplanebyPseudomo-nasfluorescensPf29A,Eur.J.PlantPathol.109(2003)61-70.[4]deSouzaJ.T.,WellerD.M.,RaaijmakersJ.M.,Frequency,diversity,andactivityof2,4-diacetylphloroglucinol-producingfluorescentPseudomonasspp.inDutchtake-alldeclinesoils,Phytopathology93(2003)54-63.[5]GriffithsR.I.,WhiteleyA.S.,O'DonnellA.G.,BaileyM.J.,RapidmethodforcoextractionofDNAandRNAfromnaturalenvironmentsforanalysisofribo-somalDNA-andrRNA-basedmicrobialcommunitycomposition,Appl.Envi-ron.Microbiol.66(2000)5488-5491.[6]GuoZ.,GuilfoyleR.A.,ThielA.J.,WangR.,SmithL.M.,Directfluorescenceanalysisofgeneticpolymorphismsbyhybridizationwitholigonucleotidearraysonglasssupports,NucleicAcidsRes.22(1994)5456-5465.[7]HaasD.,DéfagoG.,Biologicalcontrolofsoil-bornepathogensbyfluorescentpseudomonads.Nat.Rev.Microbiol.3(2005)307-319.[8]HiraishiA.,IwasakiM.,ShinjoH.,Terminalrestrictionpatternanalysisof16SrRNAgenesforthecharacterizationofbacterialcommunitiesofactivatedsludge,J.Biosci.Bioeng.90(2000)148-156.[9]KeelC.,WellerD.M.,NatschA.,DéfagoG.,CookR.J.,ThomashowL.S.,Con-servationofthe2,4-diacetylphloroglucinolbiosynthesislocusamongfluorescentPseudomonasstrainsfromdiversegeographiclocations,Appl.Environ.Microbiol.62(1996)552-563.[10]KumarS.,TamuraK.,JakobsenI.B.,NeiM.,MEGA2:molecularevolutionarygeneticsanalysissoftware,Bioinformatics17(2001)1244-1245.[11]LudwigW.,StrunkO.,WestramR.,RichterL.,MeierH.,Yadhukumar,BuchnerA.,LaiT.,SteppiS.,JobbG.,ForsterW.,BrettskeI.,GerberS.,GinhartA.W.,GrossO.,GrumannS.,HermannS.,JostR.,KonigA.,LissT.,LubmannR.,702
Soyez le premier à déposer un commentaire !

17/1000 caractères maximum.