III) Protéines recombinantes en système hétérologue

De
Publié par

III) Protéines recombinantes en système hétérologue

Publié le : jeudi 21 juillet 2011
Lecture(s) : 670
Nombre de pages : 74
Voir plus Voir moins
III) Protéines recombinantes en système hétérologue
Définition
Protéines recombinantes =
protéines produites par des cellules dont l'ADN a été modifié par recombinaison génétique
Facteurs importants pour la production
Intérêt de produire des protéines recombinantes / protéines natives?
ADN
introns
ARNtranscription
ARNm
protéine
traduction
Eucaryotes 
ADN
ARN
ARN
transcription
protéinetraduction
Procaryotes (bactéries)
Différence euc/proc : chez eucaryotes : présence dintrons Pour cloner lADN eucaryote : pas possible dutiliser lADN génomique
Pour le clonage en vue de lobtention dune protéine recombinante on doit utiliser lARNm
Si la protéine nest exprimée que dans certains tissus : on doit récupérer lARNm à partir de ces cellules
Conversion ARNm en ADN : Utilisation de la technique de RT-PCR
amorce
5
ADN à cloner
Sites de restrictions pour des enzymes (intégrés grâce aux amorces de PCR)
…ATCGGGTTTAAGGCCC …. 3
GAATTCATCGGGTTTAACCGGG
3
…TAGCCCAAATTGGCCC …. 5
Plasmide comme vecteur de clonage
La ligature
Fragment d’ADN
Vecteur recombinant
vecteur
bactérie
Vecteur
recombinant
bactérie transformée
antibiotique
Sélection basée sur la résistance aux ATB:
bactérie avec vecteurs prolifère
antibiotique
bactérie sans vecteurs meurt
Soyez le premier à déposer un commentaire !

17/1000 caractères maximum.