III) Protéines recombinantes en système hétérologue
74 pages
Français
Obtenez un accès à la bibliothèque pour le consulter en ligne
En savoir plus

III) Protéines recombinantes en système hétérologue

-

Obtenez un accès à la bibliothèque pour le consulter en ligne
En savoir plus
74 pages
Français

Description

III) Protéines recombinantes en système hétérologue

Sujets

Informations

Publié par
Nombre de lectures 540
Langue Français
Poids de l'ouvrage 2 Mo

Exrait

III) Protéines recombinantes en système hétérologue
Définition
Protéines recombinantes =
protéines produites par des cellules dont l'ADN a été modifié par recombinaison génétique
Facteurs importants pour la production
Intérêt de produire des protéines recombinantes / protéines natives?
ADN
introns
ARNtranscription
ARNm
protéine
traduction
Eucaryotes 
ADN
ARN
ARN
transcription
protéinetraduction
Procaryotes (bactéries)
Différence euc/proc : chez eucaryotes : présence dintrons Pour cloner lADN eucaryote : pas possible dutiliser lADN génomique
Pour le clonage en vue de lobtention dune protéine recombinante on doit utiliser lARNm
Si la protéine nest exprimée que dans certains tissus : on doit récupérer lARNm à partir de ces cellules
Conversion ARNm en ADN : Utilisation de la technique de RT-PCR
amorce
5
ADN à cloner
Sites de restrictions pour des enzymes (intégrés grâce aux amorces de PCR)
…ATCGGGTTTAAGGCCC …. 3
GAATTCATCGGGTTTAACCGGG
3
…TAGCCCAAATTGGCCC …. 5
  • Accueil Accueil
  • Univers Univers
  • Ebooks Ebooks
  • Livres audio Livres audio
  • Presse Presse
  • BD BD
  • Documents Documents