Cet ouvrage fait partie de la bibliothèque YouScribe
Obtenez un accès à la bibliothèque pour le lire en ligne
En savoir plus

III) Protéines recombinantes en système hétérologue

De
74 pages

III) Protéines recombinantes en système hétérologue

Publié par :
Ajouté le : 21 juillet 2011
Lecture(s) : 756
Signaler un abus
III) Protéines recombinantes en système hétérologue
Définition
Protéines recombinantes =
protéines produites par des cellules dont l'ADN a été modifié par recombinaison génétique
Facteurs importants pour la production
Intérêt de produire des protéines recombinantes / protéines natives?
ADN
introns
ARNtranscription
ARNm
protéine
traduction
Eucaryotes 
ADN
ARN
ARN
transcription
protéinetraduction
Procaryotes (bactéries)
Différence euc/proc : chez eucaryotes : présence dintrons Pour cloner lADN eucaryote : pas possible dutiliser lADN génomique
Pour le clonage en vue de lobtention dune protéine recombinante on doit utiliser lARNm
Si la protéine nest exprimée que dans certains tissus : on doit récupérer lARNm à partir de ces cellules
Conversion ARNm en ADN : Utilisation de la technique de RT-PCR
amorce
5
ADN à cloner
Sites de restrictions pour des enzymes (intégrés grâce aux amorces de PCR)
…ATCGGGTTTAAGGCCC …. 3
GAATTCATCGGGTTTAACCGGG
3
…TAGCCCAAATTGGCCC …. 5
Un pour Un
Permettre à tous d'accéder à la lecture
Pour chaque accès à la bibliothèque, YouScribe donne un accès à une personne dans le besoin