BAC STL 2015 - Sous-épreuve écrite de Chimie-biochimie - sciences du vivant
3 pages
Français

BAC STL 2015 - Sous-épreuve écrite de Chimie-biochimie - sciences du vivant

-

Le téléchargement nécessite un accès à la bibliothèque YouScribe
Tout savoir sur nos offres
3 pages
Français
Le téléchargement nécessite un accès à la bibliothèque YouScribe
Tout savoir sur nos offres

Description

BAC STL 2015 - Sous-épreuve écrite de Chimie-biochimie - sciences du vivant

Sujets

Informations

Publié par
Publié le 22 juin 2015
Nombre de lectures 2 653
Langue Français

Extrait

BAC STL 2015Sousépreuve écrite de Chimie  biochimiesciences du vivant
Il s’agit dequelques pistes d’analyse pour ce sujetet non pasd’un corrigétype:
Partie 1Utilisation dune bactérie Photosynthétique pour traiter les sols contaminés dans la région de Fukushima
Questions :
1.1:
Le document A nous indique bien quil sagit dune dégradation de la matière organique et de dégradations des molécules.
Il sagit donc bien dune voie catabolique
1.2:
Alcool (Hydroxyle)
1.3Voir dessin du 1.2 1.41.5 :
On utilise la règle du gamma pour déterminer les demi-équations électroniques ainsi que la réaction favorisée. Il suffit ensuite déquilibrer les demi-équations avec des coefficients pour réaliser léquation doxydoréduction 1.6: Lespèce qui subit la réduction est celle dont le nombre doxydation baisse durant la réaction. 1.7:
Lenthalpie de réaction est négative donc la réaction est exergonique. 1.8: Lactobacillus casei est organotrophe, rodobactersphaeroïdes est photosynthétique. 1.9:
Rodobactersphaeroïdes est photosynthétique donc elle a besoin de lumière pour se développer dun milieu de vie restreint aux couches superficielles du sol.
1.10: Rodobactersphaeroïdes incorpore les matières minérales dont le césium radioactif. Cette bactérie vivant à la surface du sol, lensemble ne peut se diffuser dans les couches plus profondes.
Partie 2Les effets de la radioactivité sur les papillons bleus du Japon
Questions : 2.1 :
Lactivité du césium 137 décroit en suivant une courbe en cloche avec léloignement de la centrale.
2.2 :
Le taux de malformation des papillons suit la même courbe que lactivité du Césium 137. On peut donc émettre lhypothèse que ces données sont liées.
2.3 : Les papillons issus de larves irradiées ont des ailes antérieures plus petites et de taille plus variable. Des tâches irrégulières, des pattes et des antennes plus petites et de longueurs plus variables ainsi quune absence de bandes blanches sur les antennes.
Il sagit donc certainement de la conséquence dune mutation dun ou plusieurs gènes suite à des radiations. 2.4 :
Sur lallèle muté, la mutation se situe sur le nucléotide 64. Il sagit dune substitution
2.5 : Allèle sauvage :
GGCUUCUAUAGCGGCCAGAG
Allèle muté
GGCGUCUAUAGCGGCCAGAG 2.6 : Allèle sauvage :
Gly Phé Tyr Ser Gly Gln Allèle muté
Gly Val Tyr Ser Gly Gln
2.7 : On remarque le remplacement de la phénilalanine par la valine.
2.8 : La synthèse doit faire le rapprochement entre les données obtenues au niveau génotypiques, phénotypiques, et environnementales. On pourra partir des données expérimentales pour remonter vers linfluence du césium 137 et ainsi démontrer me rapport entre le dégagement massif de césium 137 lors de laccident de Fukushima et le développement modifié des papillons bleus du Japon.
  • Accueil Accueil
  • Univers Univers
  • Ebooks Ebooks
  • Livres audio Livres audio
  • Presse Presse
  • BD BD
  • Documents Documents