Lecture 8: Patterns, Profiles, and Motifs

Lowek

Description

• cours magistral

Lecture 8: Patterns, Profiles, and Motifs• Finding patterns in protein and DNA sequences• Calculating profiles of DNA sequences Some slides adapted from slides from Dr. Keith DunkerSome slides adapted from slides created by Dr. Zhiping Weng (Boston University) Definitions and Resources§ Motif: A region of a protein or DNA sequence that may be functionally or structurally significant and/or conserved in other sequences• Motifs usually contain biologically important sequences§ Pattern: Describes a motif using a qualitative consensus sequence (e.

• gal3 cggtccactgtgtgccggal7 cggagcactgttgagcggal80 cggcgcactctcgcccggcy1 cggggcagactattccggal1 cggattagaagccgccgcgggcgacagccctccgcggaagactctcctccggal10 cggaggagagtcttccgcggagggctgtcgcccgcggcggcttctaatccggal2 cggaaagcttccttccgcggcggtctttcgtccgcggagatatctgcgccgcggggcggatcactccgcggatcactccgaaccgpcl10 cggagtatattgcaccgmth1 cggggaaatggagtccg gal4 tata
• test sequence
• dna sequence profile
• pattern
• protein

Sujets

• Cours magistral
• Boston University
• Profilé
• Protein
• Pattern

Informations

• Publié par: bomel
• Nombre de lectures: 34
• Langue: English
• Poids de l'ouvrage: 1 Mo

Extrait

NEWSLETTER
MAY 2008 AYAY

Heath students go ‘Live’ on
TV with BBC Schools Project
If you know of anything that is happening in and
around our school community, let us know, or if you
have any comments about the newsletter,

e-mail: [e-mail]
www.heathtechnologycollege.co.uk “No compromise on standards”
Message from the Head teacher
It has been another busy half-term at The Heath and our students and staff have
continued to work hard. Many of our students will be sitting GCSE’s SATs and
school exams, we wish them every success and look forward to their results in
the summer. In addition to academic work our students have excelled in other
areas, two recent highlights were the Halton Dance Extravaganza at The Brindley
where The Heath won the overall prize for the night and a win for Year 10 Boys in
the Halton and Warrington Emerging Schools Cup Final. Well Done to all those
involved. Thank you to all the staff for their hard work and to parents and carers
for your continuing support.


Update/Reminder about standards

The school seeks to have high standards of dress, behav-
iour, achievement and presentation. The following is a clari-
fication of our expectations regarding hairstyles/colour.

Male students
Students should not have a shaved head using below a
number two setting. Long hair must be kept tidy. Hair col-
our should be kept within the natural range e.g. blonde, bru-
nette or natural red.

Female students
Students should have hair of a natural colour as artificial
colours are seen as ‘extreme.’ Hair should be in the natural
colour range e.g. blonde, brunette, natural red.

For all students hair should not be pink, purple, artificial red or blue for example. Persistant
refusal to keep to these guidelines will result in isolation.

We also request your help regarding make up. Girls are coming to school with heavily made
up faces. Girls are asked to remove this and we ask for your assistance in this matter.

Mrs Cassin
Assistant Head teacher

“In the business of learning”
Page 2 Learn to Earn Day

Learn to Earn day took place recently where
students had a full day off timetable and a
chance to learn about business, enterprise and
work related learning. A different programme of
activities for each year group meant and excit-
ing and fun packed day for everyone involved.

Year 7 went to St Helen’s glass to learn about
how a big business works. Year 8 worked in
form groups exploring their options for the fu-
ture, they also had guest speakers and took
part in an occupations parade where they could
dress up in clothing appropriate to what they would like to do in the future. Year 9 participated
in the enterprise game. Year 10 designed and ran a airline for a day taking part in workshops
based around the marketing mix and Year 11 worked with John Lewis partnership putting their
retailing skills to the test.

The day was a great opportunity to get a taster of what life might be like after students com-
plete education and start to make choices in the world of work. A short video of the day is
available on our website www.heathtechnologycollege.co.uk

“In the business of learning”
Page 3 BBC School Report Live
Students at The Heath took part in the BBC News School Report project recently. The aim of the
project is to teach KS3 students media and journalism skills and it is mapped to the curriculum
areas of English, ICT and Citizenship. The Heath news team trained for the event alongside
other Halton schools at the Runcorn and Widnes CLC’s and also took part in an after school me-
dia club to learn the skills they would need
for the project. Over 200 schools took part
on the day broadcasting news from their
school or local City Learning Centre’s via the
BBC’s web channels. The Heath team were
lucky enough to have an even more exciting
day however when they were invited to go
with 5 other North West schools to Liverpool
and take part in a ‘live’ program broadcast
on national television, our editor Hannah Pa-
gan, Year 9 was even interviewed on the
BBC national news at 1pm on BBC 1, it was
an amazing experience and opportunity for
all of us.

The students had to find, edit, assemble and
record news, making sure they were aware of issues such as copyright and pitching it at a level
suitable for their audience. Each member of the team
had a specialist role such as editor, presenter, reporter,
camerman, researcher, script writer etc and learned
lots of new skills training for the roles. The team also
met famous people including Gordon Burns, Adam
Flemming, and Ray Quinn. It was a fantastic day.

All the students taking part were an absolute credit to
the school and really promoted the school in a positive
light at such a high profile event. Our two presenters
Jessica Rigby and Amy Wood, delivered the news
broadcast fantastically on live television and did justice
to all
the hard work that had gone on behind the
scenes beforehand. They have received a lot of
positive feedback from the BBC staff and others
that they worked with about their performance.

Thanks must go to Nick Aymes, Runcorn CLC
and Ray Weaver Widnes CLC and their staff
who provided facilities and technology for the
training events and all the BBC professionals
we had the pleasure of working with for the du-
ration of the project. Student Feedback from the BBC Project
I have learnt many things on this BBC
I definitely wouldn't have wanted to miss School report programme. The thing I Since starting this project, I have
have learnt the most is teamwork. I it for a thing!
learnt to use so much new technol-earnt that you have to listen to
ogy that I hadn’t even used before. all peoples opinions and include them
in the process and don’t exclude any-I found out how to edit interviews The BBC project has been
one out of the discussion. I have not and recorded stories. loads of fun! I am so glad that only learnt how to work in a team, but I’ve also learnt to work to a dead-
how to meet deadlines. Even though it I took part because I have
line. Having said that working to a is very hard to meet them, it is fun in learnt many new skills for the deadline was very stressful and it the process. I have also learnt how to
future. I learnt to listen to make a decent script, how to film it, didn’t leave much time for lunch
and then edit it on the IMac. others and take on their
views. Also, to make to sure Today has been great up to
I have learnt how to meet deadlines, yet. Scripting, filming and that scripts are more effective
and how to use new technology, I
even being interviewed on when they are short and have learnt what makes a report
live TV by Adam from News-more mature, and know where to snappy! Presenting live on the
edit things what things go with what. round! Which was quite scary,
day was amazing! I also have learnt how to make a as your mind goes blank
decent script. when the
camera is
right up in
your face.
















To co-ordinate the project Mrs Lowe has worked closely with the Runcorn and Widnes City
Learning Centres who have provided a training venue, technical support and expertise to stu-
dents and staff from the Halton schools as well as the equipment to make the films with. They
are being given an award for their work as a delivery partner during the project and Mrs Lowe
has been invited to accompany them to London to the Awards and a tour of Broadcasting
House to represent a school that made a significant contribution to the success of the project
in Halton. This is great news for the CLC’s and also reflects all the hard work and effort that
was put in by The Heath team to make the whole project a success.

Year 10 Residential Geography Fieldtrip to the Lake District

Once again the Year 10 Geographers ventured off
into some of the most beautiful and spectacular
scenery in England. Their three day experience on
th th27 to 29 February saw some 40 students exploring
the Cumbrian countryside. They were trying to un-
pick and explain the forces of nature that created the
landscape and to try and understand how people
now use this unique environment.

The first day saw the students arrive and they were
plunged straight away into a river study, proving for
themselves that rivers really do get bigger the further
downstream they flow. The second day was spent
exploring the Easedale valley and they walked up to Easedale Tarn, looking for evidence of past
glaciers. Finally, they explored the village of Grasmere and the lakeshore at Windermere to
study at first hand the impact of tourism.

The students really enjoyed their experience and once again a warm welcome was extended to
us at Thorney How Youth Hostel in Grasmere.

Many thanks go to Mrs Higgnett, Mr Cooper, Miss Piggott and of course to Mr Dewhurst who
stepped in at the last minute when Mr Barlow was ill.


C