Lecture 8: Patterns, Profiles, and Motifs

Lecture 8: Patterns, Profiles, and Motifs

-

Documents
12 pages
Lire
Le téléchargement nécessite un accès à la bibliothèque YouScribe
Tout savoir sur nos offres

Description

  • cours magistral
Lecture 8: Patterns, Profiles, and Motifs• Finding patterns in protein and DNA sequences• Calculating profiles of DNA sequences Some slides adapted from slides from Dr. Keith DunkerSome slides adapted from slides created by Dr. Zhiping Weng (Boston University) Definitions and Resources§ Motif: A region of a protein or DNA sequence that may be functionally or structurally significant and/or conserved in other sequences• Motifs usually contain biologically important sequences§ Pattern: Describes a motif using a qualitative consensus sequence (e.
  • gal3 cggtccactgtgtgccggal7 cggagcactgttgagcggal80 cggcgcactctcgcccggcy1 cggggcagactattccggal1 cggattagaagccgccgcgggcgacagccctccgcggaagactctcctccggal10 cggaggagagtcttccgcggagggctgtcgcccgcggcggcttctaatccggal2 cggaaagcttccttccgcggcggtctttcgtccgcggagatatctgcgccgcggggcggatcactccgcggatcactccgaaccgpcl10 cggagtatattgcaccgmth1 cggggaaatggagtccg gal4 tata
  • test sequence
  • dna sequence profile
  • pattern
  • protein

Sujets

Informations

Publié par
Nombre de lectures 34
Langue English
Signaler un problème

NEWSLETTER
MAY 2008 AYAY

Heath students go ‘Live’ on
TV with BBC Schools Project
If you know of anything that is happening in and
around our school community, let us know, or if you
have any comments about the newsletter,

e-mail: lowek@heathschool.org.uk
www.heathtechnologycollege.co.uk “No compromise on standards”
Message from the Head teacher
It has been another busy half-term at The Heath and our students and staff have
continued to work hard. Many of our students will be sitting GCSE’s SATs and
school exams, we wish them every success and look forward to their results in
the summer. In addition to academic work our students have excelled in other
areas, two recent highlights were the Halton Dance Extravaganza at The Brindley
where The Heath won the overall prize for the night and a win for Year 10 Boys in
the Halton and Warrington Emerging Schools Cup Final. Well Done to all those
involved. Thank you to all the staff for their hard work and to parents and carers
for your continuing support.


Update/Reminder about standards

The school seeks to have high standards of dress, behav-
iour, achievement and presentation. The following is a clari-
fication of our expectations regarding hairstyles/colour.

Male students
Students should not have a shaved head using below a
number two setting. Long hair must be kept tidy. Hair col-
our should be kept within the natural range e.g. blonde, bru-
nette or natural red.

Female students
Students should have hair of a natural colour as artificial
colours are seen as ‘extreme.’ Hair should be in the natural
colour range e.g. blonde, brunette, natural red.

For all students hair should not be pink, purple, artificial red or blue for example. Persistant
refusal to keep to these guidelines will result in isolation.

We also request your help regarding make up. Girls are coming to school with heavily made
up faces. Girls are asked to remove this and we ask for your assistance in this matter.

Mrs Cassin
Assistant Head teacher

“In the business of learning”
Page 2 Learn to Earn Day

Learn to Earn day took place recently where
students had a full day off timetable and a
chance to learn about business, enterprise and
work related learning. A different programme of
activities for each year group meant and excit-
ing and fun packed day for everyone involved.

Year 7 went to St Helen’s glass to learn about
how a big business works. Year 8 worked in
form groups exploring their options for the fu-
ture, they also had guest speakers and took
part in an occupations parade where they could
dress up in clothing appropriate to what they would like to do in the future. Year 9 participated
in the enterprise game. Year 10 designed and ran a airline for a day taking part in workshops
based around the marketing mix and Year 11 worked with John Lewis partnership putting their
retailing skills to the test.

The day was a great opportunity to get a taster of what life might be like after students com-
plete education and start to make choices in the world of work. A short video of the day is
available on our website www.heathtechnologycollege.co.uk

“In the business of learning”
Page 3 BBC School Report Live
Students at The Heath took part in the BBC News School Report project recently. The aim of the
project is to teach KS3 students media and journalism skills and it is mapped to the curriculum
areas of English, ICT and Citizenship. The Heath news team trained for the event alongside
other Halton schools at the Runcorn and Widnes CLC’s and also took part in an after school me-
dia club to learn the skills they would need
for the project. Over 200 schools took part
on the day broadcasting news from their
school or local City Learning Centre’s via the
BBC’s web channels. The Heath team were
lucky enough to have an even more exciting
day however when they were invited to go
with 5 other North West schools to Liverpool
and take part in a ‘live’ program broadcast
on national television, our editor Hannah Pa-
gan, Year 9 was even interviewed on the
BBC national news at 1pm on BBC 1, it was
an amazing experience and opportunity for
all of us.

The students had to find, edit, assemble and
record news, making sure they were aware of issues such as copyright and pitching it at a level
suitable for their audience. Each member of the team
had a specialist role such as editor, presenter, reporter,
camerman, researcher, script writer etc and learned
lots of new skills training for the roles. The team also
met famous people including Gordon Burns, Adam
Flemming, and Ray Quinn. It was a fantastic day.

All the students taking part were an absolute credit to
the school and really promoted the school in a positive
light at such a high profile event. Our two presenters
Jessica Rigby and Amy Wood, delivered the news
broadcast fantastically on live television and did justice
to all
the hard work that had gone on behind the
scenes beforehand. They have received a lot of
positive feedback from the BBC staff and others
that they worked with about their performance.

Thanks must go to Nick Aymes, Runcorn CLC
and Ray Weaver Widnes CLC and their staff
who provided facilities and technology for the
training events and all the BBC professionals
we had the pleasure of working with for the du-
ration of the project. Student Feedback from the BBC Project
I have learnt many things on this BBC
I definitely wouldn't have wanted to miss School report programme. The thing I Since starting this project, I have
have learnt the most is teamwork. I it for a thing!
learnt to use so much new technol-earnt that you have to listen to
ogy that I hadn’t even used before. all peoples opinions and include them
in the process and don’t exclude any-I found out how to edit interviews The BBC project has been
one out of the discussion. I have not and recorded stories. loads of fun! I am so glad that only learnt how to work in a team, but I’ve also learnt to work to a dead-
how to meet deadlines. Even though it I took part because I have
line. Having said that working to a is very hard to meet them, it is fun in learnt many new skills for the deadline was very stressful and it the process. I have also learnt how to
future. I learnt to listen to make a decent script, how to film it, didn’t leave much time for lunch
and then edit it on the IMac. others and take on their
views. Also, to make to sure Today has been great up to
I have learnt how to meet deadlines, yet. Scripting, filming and that scripts are more effective
and how to use new technology, I
even being interviewed on when they are short and have learnt what makes a report
live TV by Adam from News-more mature, and know where to snappy! Presenting live on the
edit things what things go with what. round! Which was quite scary,
day was amazing! I also have learnt how to make a as your mind goes blank
decent script. when the
camera is
right up in
your face.
















To co-ordinate the project Mrs Lowe has worked closely with the Runcorn and Widnes City
Learning Centres who have provided a training venue, technical support and expertise to stu-
dents and staff from the Halton schools as well as the equipment to make the films with. They
are being given an award for their work as a delivery partner during the project and Mrs Lowe
has been invited to accompany them to London to the Awards and a tour of Broadcasting
House to represent a school that made a significant contribution to the success of the project
in Halton. This is great news for the CLC’s and also reflects all the hard work and effort that
was put in by The Heath team to make the whole project a success.

Year 10 Residential Geography Fieldtrip to the Lake District

Once again the Year 10 Geographers ventured off
into some of the most beautiful and spectacular
scenery in England. Their three day experience on
th th27 to 29 February saw some 40 students exploring
the Cumbrian countryside. They were trying to un-
pick and explain the forces of nature that created the
landscape and to try and understand how people
now use this unique environment.

The first day saw the students arrive and they were
plunged straight away into a river study, proving for
themselves that rivers really do get bigger the further
downstream they flow. The second day was spent
exploring the Easedale valley and they walked up to Easedale Tarn, looking for evidence of past
glaciers. Finally, they explored the village of Grasmere and the lakeshore at Windermere to
study at first hand the impact of tourism.

The students really enjoyed their experience and once again a warm welcome was extended to
us at Thorney How Youth Hostel in Grasmere.

Many thanks go to Mrs Higgnett, Mr Cooper, Miss Piggott and of course to Mr Dewhurst who
stepped in at the last minute when Mr Barlow was ill.


Check out the Heath website for the latest
news and updates
Log onto
www.heathtechnologycollege.co.uk Nathan wins Diana Award

Nathan Aspinall, recently went to London to the Headquarters of The Diana Award.
He has become an invited member of The Young Anti Bullying Alliance, and has recently
gained The Diana Award for his work in the fight against bullying.
This was awarded to him at the recent
Year 10 celebration assembly by Alison
O’Brien, Director of the North West Anti-
Bullying Alliance. This award is for not
only for his peer mentoring work inside
school, but also his work for the North
West Young Anti Bullying Alliance,
where he has been elected spokesper-
son for a group of young people from
over the North West.
He attends conferences for both young
people and professionals and speaks out
for the fight against bullying with confi-
dence and knowledge, regardless of
his audience.
Nathan and Ellie with Learning Mentor Sam Jones, Alison O’Brien Di-
Nathan is an amazing ambassador for rector of the North West Anti-Bullying Alliance and David Dixon
Teaching and Learning (Behaviour and Attendance) Consultant the school and always shows us in
Secondary Strategy a fantastic light. He and Elora Bryan re-
cently attended a meeting in Oldham of
The North West Anti Bullying Alliance, where they presented to leading professionals about
their work and aims for the future.

Conwy Castle Trip
On Wednesday 7th and Friday 9th May the year 10 history students
went out to visit Conwy Castle in North Wales to collect evidence to
complete their GCSE coursework. Mr Byrne was our entertaining
tour guide, everyone had a great day and the weather was lovely.
Conwy Castle is used to develop source enquiry on the second piece
of GCSE coursework. Year 10 has worked hard to produce course-
work of a high quality after the visit. The History department has an
exceptional record of attaining top class coursework and this year
has been no exception.
All pupils behaved perfectly and showed a mature approach to com-
pleting coursework. They were a credit to The Heath School and
themselves.

Miss G Piggott
Head of History

Teaching Awards

Congratulations to Miss Hodson from the English Department who
has been nominated for the Teaching Awards. Judges from the
awards will be visiting the school to evaluate the information they
have been given and speak to staff, students and governors. “No compromise on standards”
Halton Youth Voice Awards

Representatives from the School Council at- tended the Halton Youth Voice awards at The
Halton Stadium recently where their contributions
were recognised.

The awards which included school and commu-
nity groups across the Borough of Halton recog-
nised the contributions that young people are
making in getting the youth voice heard. The af-
ternoon consisted of presentations where many
young people received certificates and interactive
sessions where the young people could learn more about what is on offer for them and ways
that they can contribute further to activities for
young people in Halton
News Team Report the Awards
The Heath's News Team attended the Halton
Youth Voice Awards recently to film events and in-
terview key people about youth participation in the
Borough. They were invited by the Youth Service
and Runcorn and Widnes CLC’s after the superb
job they did reporting on the Halton UK Youth Par-
liament elections

The team were asked to make the film after their
recent BBC training. Five members of the team
went to Halton Stadium to find out more about what had been happening. They interviewed
key people including Halton Borough Councillor Marie Wright, Director of Children's Services,
Gerald Meehan and Fiona Blacke, Chief Exectutive of The National Youth Service as well as
students and staff from schools and other providers. They were complimented on their inter-
viewing techniques, reporting skills and general enthusiasm.
Readathon 2008
KS3 students took part in Readathon recently organised in school by Mrs Ingham. The top
fundraisers and participants were

Rebecca Fisher £110
Leanne Houghton £72
Kristy Stubbs £54.50
Alexandra Parkes, Dominic Whitfield, Bethany Smith, Naomi Holland, Natalie Reynolds, Eve
Worthington, Luke Cutler, Sarah-Louise Francis, Susannah Pendlebury, Leanne Houghton,
Juliette Eatwell, Chloe Kinsella, Rebecca Jacobs, Izzy Cook

In total, nearly £500 was raised for children’s charities including the CLIC Sargent and Roald
Dahl Foundation.
Well done to all our readers!

“In the business of learning”
Page 8 “No compromise on standards”
David Ward—Journey of a Lifetime update

Fundraising for David Ward has been continuing in school. David was born with a rare congenital condition and was nominated for Journey of a Lifetime by Mrs Cassin after overcoming his diffi-
culties and succeeding at school. David will travel with other young people who have been of-
fered a place on this amazing trip to Lesotho, Namibia and South Africa and recently went to
meet his fellow travellers and be given the itinerary.

7x4, pictured left, raised £43.80 for David by holding a sponsored si-
lence.

Mr Dover and Miss Burchall ran a raffle which raised £132.80

David will also be receiving some funding from Ineos from their com-
munity fund and he will go to meet staff and collect his cheque in the
near future.

Healthy Schools Day 2008

The Heath Healthy Schools Day took place recently and stu-
dents took part in a number of sessions aiming to educate them
about the benefits and ways to live a healthy life. There were
different sessions about healthy eating, drug awareness, health
and fitness, a sports session and a mile walk to raise money for
the Sports Relief Charity.
Healthy Schools Day supports our status as a Healthy School
and was just one initiative to make sure that our students un-
derstand how to keep themselves healthy.
A short video of the day is available on our website in the latest
news section.
Kooldown
Paul and James have successfully graduated from Kooldown
Plus. They have both worked with the local fire service over the
last 10 school weeks on a variety of tasks and have com-
pleted them all to a suffi-
ciently high stan-
dard. Kooldown Plus is a
scheme which we will be
using for next academic
year.

“In the business of learning”
Page 9 “No compromise on standards”
BRINDLEY DANCE TRIUMPHS

Last month the Halton dance Extravaganda took place over 2 evenings at the Brindley Theatre.
stOn Monday 21 April it was the Key Stage 3 competition. Representing the Heath were:
Danielle Sampson Yr 7 Solo
Bethan Hancock and Rebecca Le Breton Yr 8 Duo
Jessica Rigby Yr 9 Solo

In addition we had 2 groups performing in the Yr 7-9 Group dances. The Yr 7’s did a fantastic
routine to “Carwash”. This included wearing overalls and using buckets, sponges and brushes as
props. The dance was choreographed by Jess Rigby and the groups title was “Jess’s girls”. They
were:


Leanne Houghton
Jamie Court
Bethany Hampson
Rebecca Jacobs
Sarah Francis
Sussanah Pendlebuty
Isabelle McGlough
Ellie Wilkinson
Robyn Capewell
Dayle Cleverley
Nicole Williams
Bethan Groome
Brittany Craig
Danielle Cox
Amy Wignall
Amy Crisp
Louise Roberts
Holly Tobin
Katie Ann Swanson
Katie Smith
Juliette Eatwell


The Year 8 group danced to a Lion King song, were managed and choreographed by Ashley Ja-
cobs, Year 11, and wore fantastic costumes made, as were the Yr 7 overalls by Mrs Jacobs.
They were named “Queens of the Jungle” and were:

“In the business of learning”
Page 10