SVT - Seconde
212 pages
Français

Vous pourrez modifier la taille du texte de cet ouvrage

SVT - Seconde , livre ebook

-

Obtenez un accès à la bibliothèque pour le consulter en ligne
En savoir plus
212 pages
Français

Vous pourrez modifier la taille du texte de cet ouvrage

Obtenez un accès à la bibliothèque pour le consulter en ligne
En savoir plus

Description

Nouveaux programmes. La collection Contrôle continu a été conçue pour les élèves de lycée qui souhaitent améliorer leurs connaissances et la pratique d'une matière.Mis à jour régulièrement, les livres sont découpés en chapitres et suivent scrupuleusement les nouveaux programmes de la réforme du Bac 2021.Dans cet ouvrage vous trouverez :des résumés de cours mettant en valeur les notions fondamentales et incontournables à retenirdes exercices de difficulté croissante pour aider tous les élèves quel que soit leur niveauun contrôle type devoir sur table pour s'exercerdes corrigés détaillés pour reprendre pas à pas chaque calcul et raisonnement.

Sujets

Informations

Publié par
Date de parution 05 octobre 2021
Nombre de lectures 6
EAN13 9782340062658
Langue Français
Poids de l'ouvrage 2 Mo

Informations légales : prix de location à la page 0,0550€. Cette information est donnée uniquement à titre indicatif conformément à la législation en vigueur.

Exrait

Collection « Contrôle continu » dirigée par Pascal Clavier
Retrouvez tous les titres de la collection sur www.editions-ellipses.fr




Avant-propos
Créée en 2001, la collection Contrôle continu reste encore maintenant une collection de référence pour les élèves de lycée.
Conçue dans un souci de simplicité, elle répond aux interrogations des lecteurs qui souhaitent améliorer leurs connaissances et pratique d’une matière.
Mis à jour régulièrement, les livres sont découpés en chapitres et suivent scrupuleusement les nouveaux programmes de la réforme du Bac 2021.
Chaque chapitre contient :
■ des résumés de cours mettant en valeur les notions fondamentales et incontournables à retenir
■ des exercices de difficultés croissantes pour aider tous les élèves quels que soient leurs niveaux
■ un contrôle type devoir sur table pour s’exercer
■ des corrigés détaillés pour reprendre pas à pas chaque calcul et raisonnement.
Cette collection a permis à de nombreux élèves de réussir avec succès leurs contrôles. Nous espérons qu’il en sera de même pour vous.
Pascal Clavier


Sommaire
Chapitre 1 . L’organisme pluricellulaire, un ensemble de cellules spécialisées
Chapitre 2 . Le métabolisme des cellules
Chapitre 3 . La biodiversité, résultat et étape de l’évolution
Chapitre 4 . Érosion, sédimentation et activités humaines
Chapitre 5 . Agrosystèmes et développement durable
Chapitre 6 . Agents pathogènes et maladies vectorielles
Chapitre 7 . Microbiote humain et santé
Chapitre 8 . Procréation et sexualité humaines


1 L’organisme pluricellulaire, un ensemble de cellules spécialisées
1. La cellule, unité biologique du règne vivant
L’observation des êtres vivants permet de constater qu’ils sont tous constitués de cellules.
Ce constat, partagé pour les animaux et les végétaux, mais également la notion de la cellule comme constituant et origine de chaque individu ainsi que la réfutation de la génération spontanée, ont conduit, au cours du xix e siècle, à la formulation de la théorie cellulaire :
■ tous les organismes vivants sont constitués de cellules
■ toute cellule vient d’une cellule préexistante.
La cellule apparaît comme la brique élémentaire du vivant, ou comme l’unité fonctionnelle et structurale du vivant.

La cellule : structure
La cellule peut, dans un premier temps, se définir comme une structure limitée par une membrane plasmique, contenant une information génétique, sous forme d’ADN, et contenant un cytoplasme renfermant tous les éléments nécessaires à l’expression de cette information génétique.
Il est possible, à partir de cette structure partagée par toutes les cellules, de distinguer :
■ les cellules (et les organismes) procaryotes , qui, telles les bactéries, ont une structure simple : membrane doublée d’une paroi, cytoplasme et ADN baignant dans ce cytoplasme.
■ les cellules et les organismes eucaryotes : l’information génétique est enfermée dans un noyau, et de nombreux autres organites (= petits organes cellulaires) sont présents dans le cytoplasme. Parmi eux :
▪ mitochondries, productrices d’énergie des cellules ;
▪ réticulum : ensemble de sacs membranaires à l’origine des protéines sécrétées et pouvant stocker et métaboliser les lipides ;
▪ appareil de Golgi : saccules aplatis capables d’effectuer la maturation des protéines destinées à la sécrétion ;
▪ cytosquelette, qui donne leur forme aux cellules et permet les mouvements des cellules mais aussi dans les cellules ;
▪ ribosomes, assurant la synthèse des protéines ;
▪ paroi (chez les végétaux) entourant la cellule et servant d’armature ;
▪ chloroplastes (chez les végétaux) assurant la photosynthèse.
▪ vacuole, chez les végétaux, assurant des stockages (eau, métabolites…).

Cellules procaryotes (à gauche, une bactérie) et eucaryotes (à droite, cellule animale)
Chez les êtres unicellulaires, procaryotes ou eucaryotes, la cellule unique constituant l’organisme doit accomplir toutes les fonctions (nutrition, excrétion, reproduction, locomotion…).

Un exemple d’organisme unicellulaire eucaryote : la Paramécie
Source Wikimedia Commons
En revanche, dans le cas des organismes pluricellulaires, il existe une spécialisation cellulaire : chaque cellule n’accomplit qu’une tâche déterminée, parmi celles qui sont indispensables à l’organisme.
2. Cellule et organismes pluricellulaires
De nombreux êtres vivants sont constitués de cellules plus ou moins nombreuses.
Par exemple, chez un ver, Caenorhabditis elegans , les adultes sont constitués de 959 cellules. Chez l’homme, on en compte environ 30 000 milliards.
Une matrice extra-cellulaire (MEC), entre ces cellules, assure la cohésion de l’ensemble.
La matrice extra-cellulaire contient des fibres ( e.g. collagène, fibrine, chez les animaux ; cellulose ou pectines chez les végétaux), sur lesquelles les cellules adhèrent, grâce à des protéines membranaires spécifiques. C’est d’ailleurs la perte de cette adhésion cellulaire qui est à l’origine du phénomène de détachement cellulaire dans les tumeurs cancéreuses, ce qui conduit à la formation de métastases.

Cellule animale et MEC
Dans les organismes végétaux, c’est une paroi, composée essentiellement de cellulose, de pectine et de lignine qui joue le rôle de matrice extra-cellulaire. Cette paroi rigide a également un rôle à jouer dans le maintien de la plante et la protection des cellules contre l’éclatement.

Des cellules végétales et leur paroi
Dans un organisme pluricellulaire, animal comme végétal, chaque cellule n’a plus à accomplir toutes les tâches liées aux fonctions vitales. Il existe une spécialisation cellulaire, comme une sorte de répartition des tâches ou une division du travail (l’organisme a souvent été comparé à une société dans laquelle des tâches précises étaient réalisées par des cellules spécialisées).
Les cellules deviennent donc, lors de leur développement : cellules nerveuses, musculaires, sécrétrices, etc. chez les animaux, ou cellules photosynthétiques, cellules des vaisseaux conducteurs de sève, cellules absorbantes des racines, etc. chez les végétaux.

Des cellules spécialisées
Diverses études montrent que l’information génétique contenue dans les cellules non sexuelles d’un organisme est la même. Cependant, les cellules n’ont pas la même forme, n’ont pas les mêmes caractéristiques et n’accomplissent pas les mêmes tâches lorsqu’elles sont différenciées. Cela signifie que, sur la totalité des gènes que ces cellules possèdent (à l’exception, encore une fois, des cellules sexuelles) elles n’en n’expriment qu’une partie.
La différenciation cellulaire, qui conduit à la formation de ces cellules spécialisées, apparaît donc comme une expression différentielle de certains gènes, sur l’ensemble des gènes propres à l’organisme.
3. Cellule et information génétique
La transmission de caractères héréditaires d’une cellule à une autre ou d’un organisme à un autre, montre qu’il existe une information génétique dans les organismes. C’est cette information génétique qui se transmet d’un individu à un autre et qui est à l’origine du développement des caractères héréditaires.
Diverses observations, faites depuis le début du xx e siècle, ont permis d’aboutir à la conclusion que le support moléculaire de cette information génétique est la molécule d’ADN (acide désoxyribonucléique), dont la structure a été élucidée en 1953 par Watson, Crick, Franklin et Wilkins.
Cette molécule est présente dans le noyau des cellules eucaryotes et dans le cytoplasme des cellules procaryotes.
La structure de l’ADN
L’ADN est donc la molécule qui, dans les cellules, porte les informations nécessaires à la mise en place des caractères héréditaires et au développement des organismes eux-mêmes.
Comment une molécule peut-elle porter une information ?

ADN
Acide désoxyribonucléique : molécule bicaténaire, en double hélice, formée de deux chaînes de nucléotides complémentaires. Il s’agit d’une molécule codée, qui renferme, dans la séquence des nucléotides qui la composent, notre information génétique. C’est cette molécule qui se transmet de cellule à cellule lors de la division cellulaire et de parent à enfant lors de la reproduction sexuée.
En lien avec l’environnement, l’ADN (et les gènes qu’il contient) est responsable du développement de nos caractères.
La molécule d’ADN est une longue suite ordonnée (c’est-à-dire une séquence) de nucléotides.
Un nucléotide est le résultat de l’association de trois éléments : un acide phosphorique, un sucre à 5 atomes de carbone, le désoxyribose, et une base azotée.

Structure d’un nucléotide
Il existe quatre bases azotées dans l’ADN, et il existe donc quatre nucléotides différents. Les quatre bases azotées sont : l’adénine (symbolisée par A), la thymine (T), la cytosine (C) et la guanine (G).
Ces bases sont complémentaires deux à deux : une base A se place toujours en face d’une base T, et une base C se place toujours en face d’une base G. Ce sont ainsi deux paires de bases azotées (et donc de nucléotides) qui existent : A-T et C-G.

Les paires de bases complémentaires
Les nucléotides se relient les uns aux autres par l’intermédiaire de liaisons entre le sucre et le phosphate. Il se définit donc une succession de nucléotides porteurs de bases azotées, qui s’enchaînent alors dans un ordre précis.
AATCGTCGTCCATGGCCC… est, par exemple, une succession de bases azotées qui peut être portée par un brin de molécule d’ADN.
Les brins d’ADN s’associent deux par deux, par l’intermédiaire des bases complémentaires.

Un fragment de la molécule bicaténaire d’ADN
Ainsi, si un brin a pour séquence de nucléotides AATCTGG, le brin qui lui est associé et complémentaire est TTAGACC.
Les deux brins s’enroulent l’un autour de l’autre dans l’espace et forment une double hélice caractéristique.
ADN et information génétique
Les nucléotides de l’ADN se succèdent dans un ordre précis. Cela définit une séquence, c’est-à-dire une suite ordonnée d’éléments. C’est dans l’ordre dans lequel se succèdent les nucléotides que se trouve l’information génétique. La séquence des nucléotides permet d’inscrire, en quelque sorte, dans une molécule, une instruction. Mais contrairement à nos instructions écrites habituellement dans un alphabet de 26 lettres, les instructions contenues par la molécule d’ADN sont « écrites » avec un alphabet de 4 lettres (les quatre bases A, T, C et G).
C’est dans la succession de ces bases azotées dans les molécules d’ADN que se trouve l’information génétique : il faut considérer cette séquence de nucléotides comme une véritable phrase codée.
Un morceau d’ADN ayant pour séquence nucléotidique AATCTGGTCTGAATGCGTTT a une signification précise pour la cellule, et un morceau d’ADN de séquence ATTCTGCTCTAATGCGTTTG a une signification différente, même si ces séquences sont semblables.
Autrement dit, pour une suite de n nucléotides de longueur, il existe 4 n séquences possibles.
Ce sont ces molécules d’ADN qui codent pour nos caractères héréditaires, y compris pour des maladies héréditaires qui peuvent affecter les uns ou les autres (mucoviscidose, myopathie…).
L’expression de l’information génétique passe par la synthèse de protéines, dont la structure est déterminée par la séquence nucléotidique d’un gène. Grossièrement, on peut associer un gène (séquence de nucléotides, message héréditaire « codé ») à une protéine (séquence d’acides aminés mise en place sous les « ordres » d’un gène, d’une portion d’ADN) et à un caractère (élément du phénotype qui dépend de l’activité d’une protéine et donc d’un gène).
C’est l’information génétique qui est transmise d’un parent à un descendant, et non des caractères. Dire d’un enfant qu’il a les yeux de son père ne signifie pas que le père s’est arraché les yeux pour les donner à son fils, mais que le père a transmis à son fils une information génétique qui détermine le fait que la forme et/ou la couleur des yeux du fils sont semblables à celles du père.
Il faut noter que toutes les cellules d’un organisme pluricellulaire (à l’exception des cellules reproductrices) ont la même information génétique. Une cellule rénale, une cellule nerveuse, une cellule de l’épithélium buccal possèdent la totalité de l’information génétique de l’organisme. C’est d’ailleurs cette caractéristique qui rend théoriquement envisageable de cloner un individu avec une cellule prélevée sur une partie quelconque de son corps.
L’identité de l’information génétique des différentes cellules d’un même organisme tient au fait que toutes ces cellules descendent de la même cellule-œuf initiale, par des mécanismes de reproduction conforme qui assurent la stabilité de cette information génétique de division en division.
Gènes, chromosomes, spécialisation cellulaire
On définit un gène comme la portion d’information génétique (et donc la portion de la molécule d’ADN) qui participe à l’expression d’un caractère précis.
On compte environ 20 à 30 000 gènes dans l’espèce humaine.
Tous les individus humains possèdent les mêmes gènes. En revanche, comme il existe plusieurs versions d’un même gène (ces versions sont nommées allèles), chaque individu humain a une information génétique qui lui est propre.
Pour ne prendre l’exemple que d’un seul gène, le gène ABO code pour notre groupe sanguin dans le système ABO ; ce gène, situé sur la paire n° 9 de chromosomes dans l’espèce humaine, peut se présenter sous trois formes différentes : A, B ou o.
Ainsi, même si nous avons tous en commun le fait de posséder le gène ABO, nous pouvons être différents les uns des autres car nous n’avons pas les mêmes allèles.

Gène
Un gène est une portion de la molécule d’ADN et donc une partie de l’information génétique, qui code pour un caractère. Un gène occupe une place précise sur un chromosome.
Les gènes peuvent être localisés sur les chromosomes. Ceux-ci représentent une forme compactée de l’information génétique, qui apparaît au cours de périodes de division cellulaire. Un chromosome contient l’ADN, sous forme compacte, et associé à des protéines.

De l’ADN au chromosome : l’information génétique
Source : NIH, User:Phrood~commonswiki, Public domain, via Wikimedia Commons
Les gènes étant des portions d’ADN, il est logique de penser qu’un gène occupe une place précise sur un chromosome.
Le nombre de chromosomes caractéristique de l’espèce humaine est 2n = 46. Cela signifie que nous possédons 23 paires (c’est ce que représente le « 2n ») de chromosomes. Chaque cellule d’un organisme présente, à l’exception des cellules reproductrices, les mêmes chromosomes.
Les cellules d’un organisme ayant donc les mêmes chromosomes, les mêmes gènes, et donc la même information génétique, comment est-il possible que ces cellules puissent se différencier, présenter des formes et des fonctions variées ?
Ce phénomène est lié, comme cela a été suggéré dans le paragraphe 2, au fait que sur la totalité des gènes qu’une cellule possède, seule une partie est exprimée à un moment donné.
4. Les différents niveaux d’organisation du vivant
Différents niveaux d’observation et d’analyse
Un organisme pluricellulaire est constitué par définition de nombreuses cellules. Celles-ci renferment des organites qui leur donnent leurs fonctions.
Les organites sont eux-mêmes constitués de molécules, formées d’atomes.
Il apparaît donc, à l’échelle microscopique différents niveaux d’organisation du vivant.
Mais à une autre échelle, différents niveaux peuvent aussi être décrits :
Les cellules s’associent les unes avec les autres pour constituer des tissus.
Si l’on prend en compte les niveaux d’organisation supérieurs à la cellule et ceux qui lui sont inférieurs, différents niveaux peuvent être décrits :
■ Population : ensemble d’organismes de la même espèce, partageant un même espace de vie
■ Individu : c’est l’organisme, qui vit, se déplace, a une croissance, se reproduit…
■ Appareil (ou système) : ensemble d’organes participant à une même fonction biologique (appareil reproducteur, appareil digestif, appareil circulatoire, appareil racinaire…).
■ Organe : partie d’un appareil assurant une tâche précise dans une grande fonction biologique (cœur, estomac, foie, testicules, fruit, racine…).
■ Tissu : association de cellules, entrant, en collaboration avec d’autres tissus, dans la constitution des organes (tissu nerveux, musculaire, sécréteur…).
Un tissu est un ensemble de cellules semblables, engagées dans l’accomplissement d’une même fonction. Au sein d’un tissu, les cellules sont liées par une matrice extra-cellulaire (MEC) dans laquelle se trouvent des molécules d’adhésion cellulaire, mais également des fibres donnant aux tissus leur résistance et/ou leur élasticité.
Chez les animaux, il existe quatre grands types tissulaires, subdivisés en sous-types :
■ Tissu épithélial : les cellules sont jointives et reposent sur une lame basale fibreuse. On distingue deux épithéliums :
▪ de revêtement (épiderme, épithélium absorbant de l’intestin…)

Un tissu épithélial
▪ sécréteur : sécrétion endocrines (hormones) ou exocrines (sucs digestifs)
■ Tissu conjonctif : les cellules sont non jointives, accompagnées d’une MEC riches en fibres (élastine, collagène…) et parfois minéralisée (dans le cas de l’os). Rôle de remplissage, de soutien…
▪ sous-types : tissu osseux, cartilagineux, adipeux, sanguin…

Un exemple de tissu conjonctif
■ Tissu nerveux : assure, par les cellules qui le composent (les neurones), la communication entre des organes et des centres nerveux.
■ Tissu musculaire : sa principale caractéristique est sa contractilité. La contraction des muscles entraîne un mouvement des parties auxquelles ils sont rattachés.
Il existe également des tissus végétaux, constitutifs des organes tels que racines, feuilles, fruits… Ces tissus (parenchyme chlorophyllien, xylème, phloème, suber…) assurent diverses fonctions, de la photosynthèse au maintien de la plante.
Au sein d’un organe, différents tissus coexistent, chacun ayant un rôle à jouer dans le rôle global de l’organe.
Dans la paroi du tube digestif, par exemple, on trouve, de l’intérieur vers l’extérieur, une muqueuse, limitée par un tissu épithélial : les cellules jointives assurent l’imperméabilité, et des cellules sécrétrices sont responsables de la présence d’un mucus protecteur. En dessous de cet épithélium, se trouve un tissu conjonctif (sous-muqueuse), irrigué, puis, en allant encore vers l’extérieur, se trouve une musculeuse dont le rôle est de permettre des contractions de la paroi du tube, ce qui assure le brassage du bol alimentaire. Enfin, tout à l’extérieur il existe une séreuse de nature conjonctive, élastique et résistante. Des cellules nerveuses innervent également cette paroi.
■ Cellule : c’est l’unité fondamentale du vivant. C’est le plus petit élément capable d’une vie autonome. Elle est limitée par une membrane plasmique et contient une information génétique.
■ Organite : petit organe à l’intérieur d’une cellule, qui assure une fonction précise. La plupart sont entourés d’une membrane (noyau, réticulum, mitochondries, chloroplastes…). Les ribosomes sont dépourvus de membrane mais peuvent au sens large, être considérés comme des organites.

Un appareil de Golgi, ensemble de « sacs membranaires » aplatis, au sein d’une cellule animale
Source Wikipedia

Le noyau (entouré par des « sacs » de réticulum)
Source Wikipedia

Un chloroplaste, organite caractéristique des végétaux
Source Wikipedia
■ Molécule : assemblage d’atomes (eau : H 2 O ; glucose : C 6 H 12 O 6 , protéines, ADN…).

Une représentation d’une molécule de glucose : on y compte 6 atomes de carbone, 6 atomes d’oxygène et 12 atomes d’hydrogène. Sa formule brute est donc C 6 H 12 O 6 . Modifié d’après libmol
■ Atome : élément fondamental de la matière (C : Carbone, O : Oxygène, H : Hydrogène…).
Différentes échelles de taille
Les différents niveaux d’observation du vivant ont des échelles très différentes : une population s’observe sur l’échelle d’un territoire qui peut être de plusieurs km 2 , mais les atomes et les molécules ont des tailles nanométriques.
Les méthodes d’observation ne sont évidemment pas non plus les mêmes :
■ observation à l’œil nu pour des niveaux dont l’échelle est supérieure au mm (organe, organisme, population…)
■ observation à la loupe pour des niveaux dont l’échelle est voisine de 1 ou 0,1 mm (certains organes, cellules végétales dont on devine le contour, détails d’organes animaux et végétaux…)
■ observation au microscope optique (celui que vous utilisez au lycée), pour les niveaux dont l’échelle est comprise entre 100 et 0,5 µm environ (cellules, certains organites)
■ observation au microscope électronique pour des niveaux dont la taille est comprise entre 0,5 µm et 1 à 2 nm environ (organites, macromolécules…).
En dessous de ces tailles, il faut faire appel à des matériels très sophistiqués (et très coûteux) : microscope à effet tunnel par exemple, pour visualiser les atomes.
Lorsque des appareils de grossissement sont utilisés, il faut savoir calculer le grossissement qui permet de voir une structure. Ou calculer la taille réelle de l’objet que l’on regarde, si l’on connaît le grossissement utilisé.
Une formule peut être retenue : si je regarde un objet sur une photographie, un dessin, etc., je vois sa taille apparente ( TA ).
Mais ce n’est pas sa taille réelle ( TR ), beaucoup plus petite.
J’ai choisi un appareil qui me permet d’avoir une image agrandie de cet objet, et j’ai utilisé un grossissement G .
La formule à retenir est : TA = TR × G
(autrement dit, la taille apparente, en photographie, d’un objet est « G » fois plus grande que sa taille réelle).
Cette formule peut être utilisée dans tous les sens (calculer le grossissement d’une observation si j’ai la taille réelle et la taille apparente d’un même « objet » par exemple).
Exemple
Sur une photographie, je vois un « objet » (une mitochondrie par exemple) de 4 cm, mais je sais qu’il a été agrandi et qu’en réalité il est beaucoup plus petit.
Sous la photographie, il y a un trait d’échelle, qui mesure 2 cm (c’est la taille apparente de ce trait). Au-dessus de ce trait d’échelle, est noté « 1,5 µm » : c’est ce qu’il représente dans la réalité, sa taille réelle.
Je peux alors en déduire le grossissement : 2.10 –2 /1,5.10 –6 = le grossissement est voisin de 13 000.
C’est le même grossissement qui a été utilisé pour voir et photographier mon « objet » de 4 cm. Il est donc en réalité 13 000 fois plus petit.
Sa taille est donc voisine de 3 µm.
Remarque : une méthode plus simple consistait à dire que mon « objet » est deux fois plus grand que le trait d’échelle (4 cm vs 2 cm) et donc sa taille réelle est également deux fois plus importante. La taille que représente le trait d’échelle étant de 1,5 µm, j’en conclus que mon « objet » mesure environ 3 µm.


Énoncés des exercices
* Exercice 1 10 min
Tous les chapitres du programme comportent du vocabulaire et des notions à maîtriser. Les mots croisés proposés dans les exercices permettent de vérifier que la maîtrise de la plupart d’entre eux est acquise. Il vous faut connaître, savoir définir et savoir utiliser de manière pertinente les termes présentés ici.

▬ Horizontalement
1. Type de cellules sans noyau, dont font partie les bactéries
6. Combinaison de phosphate, de désoxyribose, et d’une base azotée
7. Organite contenant l’information génétique de la cellule
10. Organite produisant l’essentiel de l’énergie cellulaire
11. Portion d’information génétique participant à l’expression d’un caractère héréditaire
12. Base azotée complémentaire de la cytosine
▬ Verticalement
2. Organite des cellules végétales assurant la photosynthèse
3. Ensemble de cellules semblables participant à une même fonction
4. Fibre protéique de la matrice extra-cellulaire
5. Molécule support de l’information génétique
8. Base azotée complémentaire de l’adénine
9. Ensemble de tissus regroupés pour accomplir une fonction précise
* Exercice 2 15 min
QCM
Pour chaque question, choisir dans les quatre propositions celle(s) qui semble(nt) correcte(s).
1. Quel élément cellulaire est propre aux cellules eucaryotes et permet de les caractériser ?
a. Le cytoplasme
b. Les ribosomes
c. Le noyau
d. La membrane plasmique
2. Quelles affirmations sont vraies à propos des organites présentés ci-dessous ?


a. Ce sont des mitochondries
b. Ce sont des éléments de l’appareil de Golgi
c. Ce sont des organites impliqués dans la production cellulaire d’énergie
d. Ce sont des ribosomes
3. Quel(s) élément(s) peut-on trouver dans la matrice extra-cellulaire ?
a. De l’ADN
b. De la cellulose
c. Du collagène
d. Des mitochondries
4. Quel tissu se définit comme un ensemble de cellules jointives reposant sur une lame basale ?
a. Le tissu nerveux
b. Le tissu musculaire
c. Le tissu conjonctif
d. Le tissu épithélial
5. Quels éléments constituent, par leur séquence, l’ADN ?
a. Les nucléotides
b. Les nucléons
c. Les phosphatides
d. Les glycérides
* Exercice 3 10 min
Le tableau ci-après présente différents niveaux d’organisation chez l’homme. Il faut relier chaque niveau d’organisation à l’ordre de grandeur qui lui correspond.
Quelques niveaux d’organisation chez l’homme
Niveau d’organisation
À relier avec
Ordre de grandeur
1. Un rein
A.10 à 20 µm
2. Un individu
B.1,75 m
3. Un atome de carbone
C.10 cm
4. Une molécule de glucose
D.70 pm (7.10 –11 m)
5. une cellule sanguine
E.1,5 nm (1,5.10 –9 m)
* Exercice 4 10 min
La photo ci-après présente une cellule.
1. S’agit-il d’une cellule procaryote ou eucaryote ? Animale ou végétale ? Justifiez.
2. Quelle est la taille (horizontalement sur la photo) de cette cellule ? Vous supposerez que vous voyez la cellule dans sa totalité
3. Faites de cette photo un dessin d’observation.

* Exercice 5 ** 20 min
Le schéma ci-dessous représente la molécule d’ADN.

1. Que signifie le sigle ADN ?
2. Légender le schéma
3. Si un brin d’ADN a une séquence telle que : ATTCACATGTCG, quelle est la séquence du brin qui lui est complémentaire ?
4. En 1950, le biologiste Chargaff a effectué le dosage des bases azotées contenues dans l’ADN prélevé chez des individus de différentes espèces.
Les résultats, présentés en pourcentage de chaque base azotée, sont donnés ci-dessous.


A
G
C
T
Pieuvre
33,2
17,6
17,6
31,6
Sauterelle
29,5
20,5
20,7
29,3
Bactérie (E. coli)
24,4
26,1
23,6
25,9
Quelles remarques peuvent être faites concernant les pourcentages de ces bases azotées ? Calculer les rapports (nombre de bases A/nombre de bases T) et (nombre de bases C/nombre de bases G) pour chaque espèce.
En utilisant les connaissances acquises à propos de la molécule d’ADN, expliquer ces résultats.
* Exercice 6 10 min
Complétez ce tableau, en indiquant par + ou – la présence ou l’absence des organites cités dans les types cellulaires envisagés dans les pages précédentes.
Tableau comparatif des organites de divers types cellulaires
Bactérie
Cellule eucaryote animale
Cellule eucaryote végétale
Membrane plasmique
Paroi
Noyau
Chloroplastes
Ribosomes
Mitochondries
Réticulum endoplasmique
* Exercice 7 25 min
1. La molécule d’ADN peut être observée au microscope électronique, en utilisant un très fort grossissement. Des photographies peuvent être prises.
La molécule d’ADN a une épaisseur de 2 nm. Quel grossissement a été utilisé si elle apparaît, sur une photographie, comme un filament de 1 mm d’épaisseur ?
2. Un érythrocyte est une cellule sanguine ayant perdu son noyau, et son rôle est le transport des gaz (O 2 et CO 2 ) dans le sang. Un érythrocyte est observé au microscope et photographié. Un grossissement × 5 000 est utilisé pour obtenir ce cliché.
Il apparaît alors comme un disque de diamètre 3,5 cm.
Quel est son diamètre réel ?
3. L’organisme humain compte environ 23 000 milliards de cellules. Le diamètre moyen de ces cellules est de l’ordre de 20 µm.
Quelle distance pourrait-on parcourir en mettant côte à côte toutes les cellules d’un seul corps humain ?
4. La photographie ci-après montre une coupe effectuée dans de la peau humaine.
Le tissu le plus superficiel est formé de cellules jointives, reposant sur une lame basale.
Le tissu sous-jacent est formé de cellules séparées, au sein d’une matrice extra-cellulaire riche en fibres de collagène et d’élastine.


Source Wikimedia Commons
a. Calculer l’épaisseur du tissu le plus superficiel
b. Identifier les deux tissus présentés.


Contrôle 1 h 30 • 20 points
* Exercice 1 45 min – 10 points
La cellule est la « brique élémentaire du vivant ». Il existe des cellules procaryotes et des cellules eucaryotes. Parmi ces dernières, il est possible de distinguer, par leur constitution et par leur mode de fonctionnement, des cellules animales et végétales.
En utilisant les connaissances acquises dans ce chapitre, effectuer une comparaison portant sur les structures des cellules eucaryotes animales et végétales.
Cette comparaison sera un texte construit d’une trentaine de lignes, accompagné d’un schéma au moins.
* Exercice 2 45 min – 10 points
En utilisant les documents suivants et vos connaissances, trouver des arguments pour justifier les affirmations suivantes :
1. L’information génétique des organismes se trouve dans le noyau
2. Les cellules d’un même organisme ont toutes la même information génétique
3. Les cellules différenciées n’expriment qu’une partie de l’information génétique qu’elles possèdent.
Vous légenderez le document 2 et indiquerez la taille de la cellule schématisée, en précisant s’il s’agit d’une cellule procaryote ou eucaryote, animale ou végétale.
Document 1.
En 1962, le biologiste anglais Gurdon a réalisé l’expérimentation suivante : sur des crapauds albinos (caractère héréditaire) adultes, il a prélevé des noyaux de cellules intestinales.
Il a également utilisé des ovocytes fécondés de la même espèce, dont il a ôté le noyau. Il a procédé à la greffe des noyaux de cellules intestinales dans les ovocytes énucléés.
Sur les cellules-œufs ainsi fabriquées par ses soins, celles qui se sont développées ont donné naissance à des crapauds albinos.
Document 2.
Le schéma ci-dessous représente une cellule.

Si cette cellule est coupée en deux, seule la partie contenant l’élément noté 4 peut régénérer une cellule entière, alors que toute partie privée de cet élément finit par dégénérer.


Corrigés des exercices
Exercice 1

Exercice 2
Question
Réponse
Commentaire
1
c
2
a, c
3
b, c
Le collagène est l’un des constituants de la matrice extra-cellulaire animale et la cellulose l’un des constituants de la paroi, matrice extra-cellulaire des végétaux.
4
d
5
a
Un nucléotide étant lui-même formé d’un acide phosphorique, d’un sucre à 5 carbones et d’une base azotée.
Exercice 3
Du plus grand au plus petit : 2-B ; 1-C ; 5-A ; 4-E ; 3-D.
Niveau d’organisation
À relier avec
Ordre de grandeur
1. Un rein
A.10 à 20 µm
2. Un individu
B.1,75 m
3. Un atome de carbone
C.10 cm
4. Une molécule de glucose
D.70 pm (7.10 –11 m)
5. une cellule sanguine
E.1,5 nm (1,5.10 –9 m)
Exercice 4
1. Cette cellule possède un noyau, c’est donc une cellule eucaryote.
Il s’agit d’une cellule animale, dépourvue de chloroplastes, de vacuole et sans paroi limitante autour de la membrane plasmique.
2. Si l’on admet voir la cellule dans sa totalité, il est possible, en largeur, de placer 13 fois le trait d’échelle. Celui-ci représente 500 nm, soit 0,5 µm, la largeur de cette cellule est de l’ordre de 13 × 0,5 = 6,5 µm environ.
3.


Exercice 5
1. ADN signifie « Acide désoxyribonucléique »
2. 1 : Nucléotide ; 2 : Phosphate ; 3 : Désoxyribose ; 4 : Paire de bases complémentaires ; 5 : Base azotée.
3. La séquence qui nous est donnée est ATTCACATGTCG
La complémentarité des bases de l’ADN impose que, face à une base A, il doit y avoir une base T (et réciproquement, et que, face à une base C, il doit y avoir une base G (et réciproquement).
Le brin complémentaire est donc : TAAGTGTACAGC
4. Quelle que soit l’espèce considérée, il y a, aux approximations près, autant de bases A que de bases T, et autant de bases C que de bases G.
Ceci est confirmé par les calculs :
pour chacune des espèces considérées, (A/T) = (C/G) = 1.
Ceci est le résultat de la structure bicaténaire de l’ADN, avec deux brins strictement complémentaires : A toujours associée à T et C toujours associée à G.
Exercice 6
+ : présence ; – : absence de l’élément
Tableau comparatif des organites de divers types cellulaires
Bactérie
Cellule eucaryote animale
Cellule eucaryote végétale
Membrane plasmique
+
+
+
Paroi 1
+

+
Noyau

+
+
Chloroplastes


+
Ribosomes
+
+
+
Mitochondries

+
+
Réticulum endoplasmique

+
+
Exercice 7
1. La molécule d’ADN a une épaisseur réelle de 2 nm (2.10 –9 m) ; elle apparaît sous la forme d’un filament de 1 mm (1.10 –3 m) d’épaisseur.
Le grossissement est 1.10 –3 /2.10 –9 = X 500 000
2. L’érythrocyte a été agrandi 5 000 fois pour avoir un diamètre de 3,5 cm (3,5.10 –2 m) sur la photo.
Sa taille réelle est donc 5 000 fois plus faible, soit 3,5.10 –2 /5 000 = 7.10 –6 m = 7 µm.
3. Il y a 23 000.10 9 cellules, et chacune a un diamètre moyen de l’ordre de 20 µm (20.10 –6 m).
La longueur totale qu’occuperait l’alignement de toutes ces cellules serait donc de 23 000.10 9 × 20.10 –6 = 460.10 6 m = 460 000 km !
4. Le tissu le plus superficiel, formé de cellules toutes jointives (et qui constituent donc une barrière imperméable) est un épithélium (c’est l’épiderme).
Le tissu plus profond est formé de cellules séparées baignant dans une matrice extra-cellulaire fibreuse, est un tissu conjonctif (c’est le derme).
L’épaisseur de l’épiderme est de l’ordre de 250 µm (environ 2,5 fois la longueur du trait d’échelle).

1. Les parois bactérienne et végétale diffèrent par leur nature.


Corrigé du contrôle
Exercice 1
Les organismes pluricellulaires animaux et végétaux sont constitués de cellules. Les cellules animales et végétales diffèrent dans leur structure par de nombreux points, mais elles présentent également des points communs, et c’est cet ensemble qui va être sommairement présenté :
Points communs : leur nature cellulaire fait que ces cellules animales et végétales sont limitées par une membrane. Dans l’espace délimité par cette membrane, se trouve un cytoplasme contenant différents organites : mitochondries, réticulum, appareil de Golgi et noyau, caractéristique des eucaryotes. Le cytoplasme contient également des ribosomes.
Ces cellules, animales comme végétales, possèdent une information génétique, enfermée dans le noyau, et présentes sous la forme d’une molécule bicaténaire en double hélice : l’acide désoxyribonucléique.
Enfin ces cellules s’assemblent en tissus (tissus épithélial ou conjonctif, par exemple pour les animaux ; tissu chlorophyllien ou conducteur de sève pour les végétaux).
L’ensemble de ces ressemblances témoigne d’une origine commune de ces cellules eucaryotes. Cependant, des différences traduisent une évolution divergente à partir de cette origine commune :
Différences structurales : Les cellules végétales présentent tous les organites des cellules animales, mais en possèdent quelques-uns qui leur sont spécifiques. Il s’agit notamment des chloroplastes, qui assurent la photosynthèse, des vacuoles, qui peuvent stocker de l’eau, et d’une paroi qui forme une sorte de squelette externe pour les cellules végétales. Cette paroi est l’analogue de la matrice extra-cellulaire qui se trouve entre les cellules animales dans les tissus.
La présence de la paroi pectocellulosique rigide donne une forme géométrique aux cellules végétales.
Enfin, ces dernières sont généralement plus grandes que les cellules animales (100 µm vs 15 à 20 µm en moyenne).
Les cellules eucaryotes animales et végétales ont une origine commune, mais ont également une évolution différente. Les différences de structure qui existent entre ces deux grands types cellulaires se répercutent dans leur fonctionnement (seules les cellules végétales pourvues de chloroplastes peuvent effectuer la photosynthèse).
Exercice 2
Il s’agit d’argumenter en faveur de trois affirmations, à partir de deux documents (expérimentations et observations) et des connaissances.
1. L’information génétique des organismes se trouve dans le noyau
Le document 2 présente une cellule (légendes : 1- Appareil de Golgi ; 2- Membrane plasmique ; 3- Cytoplasme ; 4- Noyau ; 5- Mitochondrie ; taille 18 µm). Le noyau est un organe clé de la cellule puisque sans lui la cellule meurt, alors qu’il est nécessaire pour qu’elle vive et régénère.
De plus, dans l’expérience de Gurdon, ce sont des crapauds albinos qui sont obtenus. Il s’agit d’un caractère héréditaire et cela signifie donc que ces crapauds possèdent l’information génétique conduisant au phénotype albinos. Or, le seul élément qui peut, expérimentalement, apporter cette information, est le noyau, qui a été prélevé dans des cellules de crapaud albinos.
Il semble donc bien qu’en effet, l’information génétique soit contenue dans le noyau.
2. Les cellules d’un même organisme ont toutes la même information génétique :
Il est désormais acquis que l’information génétique se trouve dans le noyau. L’information génétique contenue dans les noyaux greffés dans les ovocytes a permis le développement de crapauds entiers, alors que ces noyaux proviennent de cellules intestinales. En d’autres termes, dans le noyau des cellules intestinales se trouve la totalité de l’information génétique d’un organisme : les gènes permettant la mise en place du cœur, des poumons, des os, des yeux, du cerveau etc.
Et il n’y a aucune raison de penser que cela ne concerne que les cellules intestinales. Cela signifie donc que TOUTES les cellules d’un organisme possèdent LA TOTALITÉ de l’information génétique de cet organisme. Et donc elles ont la même information génétique.
3. Les cellules différenciées n’expriment qu’une partie de l’information génétique qu’elles possèdent :
Si toutes les cellules possèdent la même information génétique, il est cependant évident qu’elles n’ont pas la même forme, ne s’assemblent pas de la même façon en tissus, n’ont pas les mêmes fonctions. Cela signifie donc que, parmi les gènes qu’elles possèdent, chaque type de cellules n’en exprime que quelques-uns. Certaines cellules ne vont exprimer, sur l’ensemble des gènes qu’elles contiennent, que ceux qui entraînent la différenciation en cellules musculaires, d’autres cellules n’expriment que les gènes qui entraînent la spécialisation en cellules osseuses, etc.
La reproduction conforme qui permet aux organismes de se développer à partir d’une unique cellule-œuf a pour conséquence le fait que les cellules partagent toutes une même information génétique. Mais des mécanismes de différenciation et de spécialisation cellulaire font que, sur la totalité des gènes qu’elles contiennent, les cellules n’en expriment qu’une partie.


2 Le métabolisme des cellules
Il se produit, dans les cellules et les organismes, à chaque instant, des milliers de réactions biochimiques. L’ensemble de ces réactions, qui assurent la production, la transformation et l’utilisation de la matière et de l’énergie, constituent le métabolisme.

Métabolisme
Ensemble des réactions biochimiques des êtres vivants. Il se décompose en :
■ Anabolisme : réactions de biosynthèse, consommatrices d’énergie
■ Catabolisme : réactions de dégradation, de destruction de molécules, génératrices d’énergie
1. Réactions et voies métaboliques
Réactions métaboliques
Une réaction métabolique est la transformation d’un (ou plusieurs) substrat en un (ou plusieurs) produit. Le substrat se place à gauche d’une flèche réactionnelle et le produit se place à droite de cette flèche : A + B → C : les substrats A et B ont conduit à la formation du produit C.
Pour équilibrer une réaction, il faut se souvenir que, si les atomes se séparent, se recombinent au cours de la réaction pour former des molécules différentes, il n’en reste pas moins que leur nombre ne varie pas. Les atomes ne disparaissent pas et n’apparaissent pas non plus « comme ça » du néant.
Autrement dit, il doit y avoir exactement le même nombre d’atomes de carbone, d’hydrogène, d’oxygène, etc. de part et d’autre d’une flèche réactionnelle.

Exemple : comment équilibrer la réaction d’hydrolyse (de coupure par l’eau) d’un glucide tel que le maltose (formé de deux molécules de glucose assemblées) ?
Maltose (C 12 H 22 O 11 ) + x H 2 O → y glucose (C 6 H 12 O 6 )
En fait, équilibrer la réaction revient ici à déterminer les valeurs de x et de y pour avoir le même nombre d’atome C, H et O de chaque côté de la flèche.
Commençons par le carbone : il y en a 12 à gauche, on doit donc en retrouver 12 à droite. Il y en a 6 dans chaque molécule de glucose, et il faut donc deux glucose pour avoir les 12 carbones.
Donc y = 2
Il y a alors à droite 2 fois 12 = 24 atomes d’hydrogène (H) et 2 fois 6 = 12 atomes d’oxygène (O). Mais à gauche il n’y en a, dans le maltose, que 22 et 11 respectivement. Il faut donc ajouter 2 H et 1 O, soit une molécule d’H 2 O à gauche pour que la réaction soit équilibrée.
X = 1 (et dans ce cas, il est inutile de l’écrire dans la réaction)
La réaction équilibrée est donc :
Maltose (C 12 H 22 O 11 ) + H 2 O → 2 glucose (C 6 H 12 O 6 )
Voies métaboliques
Une voie métabolique est un ensemble de réactions métaboliques enchaînées. Le produit d’une réaction est le substrat de la réaction suivante, le produit de cette deuxième réaction étant à son tour le substrat d’une troisième réaction, etc. (là encore il peut, pour chaque réaction, y avoir plusieurs substrats ou plusieurs produits).

Une voie métabolique théorique : A, étape par étape, se transforme en E
Dans le bilan chimique global d’une chaîne métabolique, aucun des produits intermédiaires ne doit être écrit. Ce sont les molécules qui sont produites par une des réactions, mais utilisées par la réaction suivante (par exemple, les molécules B ou C de l’exemple précédent).
Ainsi, la voie métabolique précédente peut être résumée dans son bilan chimique, par : A → E
Ce bilan doit être équilibré exactement de la même manière que ce qui a été fait dans le paragraphe précédent.
Le métabolisme se compose donc de multiples voies métaboliques interconnectées.

Une vision théorique du métabolisme
Les cellules peuvent ainsi, selon les conditions et selon les besoins, utiliser ou produire chacune des molécules (schématisées A à N ici) de ce métabolisme complexe.
2. Les enzymes
Les enzymes sont des molécules de nature protéique, produites par les êtres vivants, et qui accélèrent les réactions biochimiques du métabolisme. Ce sont des catalyseurs. Chaque réaction métabolique fait intervenir une enzyme.
Caractéristiques des enzymes
Les enzymes présentent une double spécificité :
■ spécificité de substrat : une enzyme n’agit que sur un substrat précis ;
■ spécificité de réaction : une enzyme n’accomplit qu’une réaction précise.
Une enzyme n’assure donc que la transformation d’un substrat précis en un produit bien déterminé.
Il existe, par conséquent, une enzyme pour chaque réaction métabolique dans les cellules et les organismes, et le schéma présentant une réaction métabolique peut être complété :

Chaque enzyme n’a une activité maximale que dans des conditions précises de température et de pH.
Ces conditions, lorsqu’elles sont réunies, sont dites optimales pour l’enzyme.
Le tableau ci-dessous présente quelques exemples d’enzymes, ainsi que leurs conditions optimales d’activité :
Enzyme
Activité
pH optimal
T°C optimale
Pepsine humaine
Digestion des protéines dans l’estomac
2
37 °C
Trypsine humaine
Digestion des protéines dans l’intestin
8
37 °C
Amylase salivaire humaine
Digestion de l’amidon dans la bouche
7
37 °C
Enzyme sanguine de poisson psychrophile
Enzyme d’une espèce vivant dans les eaux froides de l’arctique
7,4
5 °C
Enzymes et information génétique
Les enzymes sont des protéines.
Les protéines sont des assemblages d’acides aminés, placés dans un ordre précis, de manière à constituer une séquence. La structure des protéines ( i.e. l’ordre dans lequel se succèdent les acides aminés) est déterminée par les gènes ( i.e. par la séquence de nucléotides de l’ADN).
La séquence d’un gène impose l’ordre dans lequel sont enchaînés des acides aminés, et détermine donc la structure d’une protéine particulière et donc enfin son activité.
Une réaction métabolique est catalysée par une enzyme précise, et est donc sous la dépendance d’un gène particulier.
Le schéma correspondant à une voie métabolique peut donc à nouveau être complété :

Il est possible, dans ces conditions, de comprendre comment une altération des gènes (une mutation) peut avoir des répercussions sur l’organisme, en considérant qu’une modification d’un gène modifie la structure et l’activité d’une enzyme et entraîne donc des perturbations dans une ou des voie(s) métabolique(s).
Ce que les parents transmettent à leurs enfants, ce sont donc des « plans de montage » de protéines, et tout particulièrement d’enzymes. L’activité de ces enzymes détermine l’apparition de tel ou tel caractère.
La spécialisation cellulaire s’explique également mieux ainsi : sur l’ensemble des « plans de montage » qu’elle possède dans la totalité de son information génétique, une cellule ne va en exploiter qu’une partie. Il n’y aura donc que certains enzymes qui seront fabriquées par une cellule précise, et dans celle-ci il n’y aura donc que quelques réactions biochimiques ce qui lui conférera son activité globale.
3. Quelques grandes voies métaboliques
Les voies métaboliques qui existent dans les organismes dépendent des enzymes que ces organismes possèdent et fabriquent, et donc dépendent des gènes que ces organismes possèdent (un gène code pour la fabrication d’une enzyme, qui, par son activité, est à l’origine de l’apparition d’un caractère).
Il existe des voies métaboliques différentes selon l’organisme considéré, puisque chaque organisme a une information génétique qui lui est propre. Cependant, certaines voies métaboliques sont très communes parmi les êtres vivants. Il s’agit en particulier de grandes voies métaboliques qui sont impliquées dans la production et l’utilisation de la matière et de l’énergie.
En outre, l’utilisation de ces voies métaboliques (qui dépend, encore une fois, de l’information génétique que les organismes possèdent, mais aussi des conditions du milieu dans lequel ces organismes se trouvent) permet de distinguer quelques grands groupes d’organismes vivants.
La photosynthèse
La photosynthèse est une voie métabolique complexe qui n’existe que chez les végétaux. Chez les végétaux eucaryotes, elle se déroule dans des organites spécialisés : les chloroplastes.
Comme son nom l’indique, elle assure la fabrication (-synthèse) de matière organique à partir de matière minérale, en utilisant la lumière (photo-) comme source d’énergie.
Le bilan de la photosynthèse (qui s’effectue en réalité en de très nombreuses étapes) est :
6 CO 2 + 6 H 2 O + énergie (lumière) → C 6 H 12 O 6 + 6 O 2 + chaleur
La photosynthèse a lieu dans des organes spécialisés dans la réception de la lumière et les échanges gazeux : les feuilles (ou leur équivalent).

La photosynthèse : schéma-bilan
L’absorption de l’énergie lumineuse est assurée dans le chloroplaste par des molécules particulières : les pigments photosynthétiques. Ceux-ci, tels que la chlorophylle, permettent la conversion de l’énergie lumineuse en énergie chimique, représentée par les sucres fabriqués par la plante.
Des transformations chimiques permettent ensuite de convertir les sucres en d’autres molécules organiques : lipides et acides aminés. Grâce à la photosynthèse, la plante est donc capable de transformer le dioxyde de carbone et l’eau en molécules organiques, nécessaires à la vie et au développement du végétal.
Les végétaux sont à la base de tous les écosystèmes, car ils fabriquent la matière organique que tous les autres êtres vivants consomment ensuite, soit de manière directe (animaux phytophages, c’est-à-dire mangeant des végétaux) ou indirecte (animaux zoophages mangeant des animaux qui eux-mêmes se sont nourris de végétaux ; nécrophages qui se nourrissent d’organismes morts). De même, ils produisent le dioxygène qui est consommé par tous les organismes.
La production de matière organique à partir de matière minérale (CO 2 et H 2 O) et de lumière toujours disponible (lumière solaire) permet aux végétaux d’être autonomes sur le plan nutritionnel : ils fabriquent eux-mêmes leurs nutriments carbonés.
Ces organismes sont dits autotrophes (ils se nourrissent eux-mêmes).
Inversement, les organismes qui ne peuvent pas faire la photosynthèse sont contraints de consommer de la matière organique « déjà fabriquée », en mangeant d’autres organismes.
Ils sont hétérotrophes (ils se nourrissent des autres).

Photosynthèse
Voie métabolique propre aux végétaux, qui permet de fabriquer de la matière organique, à partir de matière minérale et d’énergie lumineuse. Elle se déroule dans les chloroplastes, grâce à des pigments qui absorbent l’énergie lumineuse. Elle permet l’autotrophie des végétaux.
La respiration
La respiration est une voie métabolique complexe que l’on peut rencontrer chez les végétaux comme chez les animaux, les champignons, les bactéries…
Respirer, ce n’est pas inspirer et expirer. La respiration n’a pas besoin de poumons !
La respiration est un moyen très efficace et très largement répandu dans le règne vivant pour produire une énergie utilisable par les cellules. Cette énergie est véhiculée dans les cellules sous la forme d’une molécule particulière : l’adénosine triphosphate ou ATP. Mais pour fabriquer cette molécule, il faut utiliser l’énergie chimique contenue dans les nutriments organiques tels que le glucose.
La respiration est donc une voie métabolique assurant la dégradation des molécules organiques, en présence de dioxygène, permettant de produire une quantité importante d’énergie utilisable sous forme d’ATP (une autre partie de l’énergie est dissipée sous forme de chaleur).
Le bilan chimique de la respiration est :
C 6 H 12 O 6 + 6 O 2 → 6 CO 2 + 6 H 2 O + énergie (ATP et chaleur)
La respiration se déroule en plusieurs phases. L’une d’elles, la glycolyse, se produit dans le cytoplasme et utilise le glucose. Les produits de la glycolyse sont ensuite pris en charge par les mitochondries, qui vont achever la production d’énergie à partir des molécules organiques.
Ce sont les mitochondries qui assurent la production de la plus grande partie de l’énergie (à partir d’une mole de glucose, environ 38 moles d’ATP sont formées, dont 36 dans les mitochondries).

Organismes autotrophes comme hétérotrophes ont la capacité d’effectuer (à condition qu’ils disposent des enzymes, nécessaires, de mitochondries et que du dioxygène soit présent) la respiration. Ce sont les mêmes molécules organiques qui sont détruites par la respiration, produisant ainsi l’énergie indispensable aux cellules. Ce qui diffère entre autotrophes et hétérotrophes, c’est l’origine de ces molécules organiques : les autotrophes les fabriquent eux-mêmes, par des mécanismes tels que la photosynthèse, alors que les hétérotrophes doivent les consommer « toutes fabriquées » dans leur environnement.
Autotrophie et hétérotrophie se complètent donc, les autotrophes fabriquant la matière organique qui leur sert à croître et à vivre, mais aussi à nourrir les hétérotrophes. C’est donc un vaste flux de matière et d’énergie qui traverse la biosphère dans son ensemble : l’énergie solaire est convertie en matière organique (énergie chimique) par les autotrophes photosynthétiques, et cette énergie chimique peut ensuite servir de source d’énergie pour les autotrophes eux-mêmes mais aussi aux hétérotrophes, grâce à la respiration.

Les fermentations
La respiration est un moyen extrêmement efficace pour produire de l’énergie dans les cellules. Mais elle suppose de posséder des mitochondries (ce que certaines cellules n’ont pas, c’est le cas des érythrocytes = hématies) et d’avoir suffisamment de dioxygène à disposition.
Lorsque ces conditions ne sont pas réunies, il faut tout de même produire de l’énergie, sinon les cellules meurent. Dans ce cas, c’est une autre voie métabolique qui assure cette production d’énergie : la fermentation. Elle est beaucoup moins efficace que la respiration (il y a beaucoup moins d’ATP produit pour chaque molécule de glucose utilisée), mais… c’est mieux que rien !
Il est d’ailleurs plus pertinent de parler « des » fermentations, car, si le principe général est le même, les déchets du métabolisme de ces réactions peuvent être différents selon la fermentation considérée :
■ Les levures (la levure de boulanger, qui permet la fabrication du pain en est une) peuvent réaliser une fermentation éthanolique :
C 6 H 12 O 6 → 2 CO 2 + 2 C 2 H 6 O (éthanol) + énergie (ATP et chaleur)
C’est également cette fermentation qui intervient dans la fabrication du vin, de la bière, du cidre…
■ Les cellules musculaires, lorsqu’elles manquent de dioxygène, les érythrocytes, peuvent faire une fermentation lactique :
C 6 H 12 O 6 → 2 C 3 H 6 O 3 (acide lactique) + énergie (ATP et chaleur)
Il faut bien garder à l’esprit que toutes ces voies métaboliques (de la photosynthèse à la fermentation) supposent des enzymes et des structures particulières. C’est l’un des aspects de la différenciation cellulaire.
L’ensemble de ces voies est sous la dépendance d’enzymes, et par ces voies métaboliques, un large flux de matière et d’énergie traverse l’intégralité de la biosphère.


Énoncés des exercices
* Exercice 1 15 min
Tous les chapitres du programme comportent du vocabulaire et des notions à maîtriser. Les mots croisés proposés dans les exercices permettent de vérifier que la maîtrise de la plupart d’entre eux est acquise. Il vous faut connaître, savoir définir et savoir utiliser de manière pertinente les termes présentés ici.
Compléter le tableau avec les mots correspondant à chaque définition. Les mots sont à inscrire horizontalement à partir de la première case blanche dans chaque ligne. La colonne verticale grisée fait alors apparaître un nouveau terme, à définir.

1. Ensemble des réactions biochimiques des cellules
2. Molécule qui est transformée en produit au cours d’une réaction
3. Organite assurant la respiration
4. Organite assurant la photosynthèse
5. Mode métabolique qui impose de consommer de la matière organique « toute prête »
6. Voie métabolique assurant la production d’én

  • Accueil Accueil
  • Univers Univers
  • Ebooks Ebooks
  • Livres audio Livres audio
  • Presse Presse
  • BD BD
  • Documents Documents